ID: 1124439355

View in Genome Browser
Species Human (GRCh38)
Location 15:29675269-29675291
Sequence TGAGCGTGGCAGCTGCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124439343_1124439355 10 Left 1124439343 15:29675236-29675258 CCCCCGCTTTGGCCACCCAGGCA No data
Right 1124439355 15:29675269-29675291 TGAGCGTGGCAGCTGCTGCCGGG No data
1124439340_1124439355 16 Left 1124439340 15:29675230-29675252 CCCAGGCCCCCGCTTTGGCCACC No data
Right 1124439355 15:29675269-29675291 TGAGCGTGGCAGCTGCTGCCGGG No data
1124439345_1124439355 8 Left 1124439345 15:29675238-29675260 CCCGCTTTGGCCACCCAGGCACT No data
Right 1124439355 15:29675269-29675291 TGAGCGTGGCAGCTGCTGCCGGG No data
1124439346_1124439355 7 Left 1124439346 15:29675239-29675261 CCGCTTTGGCCACCCAGGCACTT No data
Right 1124439355 15:29675269-29675291 TGAGCGTGGCAGCTGCTGCCGGG No data
1124439339_1124439355 17 Left 1124439339 15:29675229-29675251 CCCCAGGCCCCCGCTTTGGCCAC No data
Right 1124439355 15:29675269-29675291 TGAGCGTGGCAGCTGCTGCCGGG No data
1124439344_1124439355 9 Left 1124439344 15:29675237-29675259 CCCCGCTTTGGCCACCCAGGCAC No data
Right 1124439355 15:29675269-29675291 TGAGCGTGGCAGCTGCTGCCGGG No data
1124439341_1124439355 15 Left 1124439341 15:29675231-29675253 CCAGGCCCCCGCTTTGGCCACCC No data
Right 1124439355 15:29675269-29675291 TGAGCGTGGCAGCTGCTGCCGGG No data
1124439349_1124439355 -6 Left 1124439349 15:29675252-29675274 CCAGGCACTTTCCGCCCTGAGCG No data
Right 1124439355 15:29675269-29675291 TGAGCGTGGCAGCTGCTGCCGGG No data
1124439347_1124439355 -2 Left 1124439347 15:29675248-29675270 CCACCCAGGCACTTTCCGCCCTG No data
Right 1124439355 15:29675269-29675291 TGAGCGTGGCAGCTGCTGCCGGG No data
1124439348_1124439355 -5 Left 1124439348 15:29675251-29675273 CCCAGGCACTTTCCGCCCTGAGC No data
Right 1124439355 15:29675269-29675291 TGAGCGTGGCAGCTGCTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124439355 Original CRISPR TGAGCGTGGCAGCTGCTGCC GGG Intergenic
No off target data available for this crispr