ID: 1124440275

View in Genome Browser
Species Human (GRCh38)
Location 15:29680753-29680775
Sequence AAACTCTGCTTCACAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124440273_1124440275 20 Left 1124440273 15:29680710-29680732 CCAGTCTGCTCTGTAATCTCGTT No data
Right 1124440275 15:29680753-29680775 AAACTCTGCTTCACAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124440275 Original CRISPR AAACTCTGCTTCACAAACAC AGG Intergenic
No off target data available for this crispr