ID: 1124441438

View in Genome Browser
Species Human (GRCh38)
Location 15:29688921-29688943
Sequence TGAAGTAGACGCCATCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124441433_1124441438 13 Left 1124441433 15:29688885-29688907 CCTGTGACAGAGCATCCATGCCA No data
Right 1124441438 15:29688921-29688943 TGAAGTAGACGCCATCATCGTGG No data
1124441436_1124441438 -7 Left 1124441436 15:29688905-29688927 CCACGCGGCTGCTCCATGAAGTA No data
Right 1124441438 15:29688921-29688943 TGAAGTAGACGCCATCATCGTGG No data
1124441435_1124441438 -2 Left 1124441435 15:29688900-29688922 CCATGCCACGCGGCTGCTCCATG No data
Right 1124441438 15:29688921-29688943 TGAAGTAGACGCCATCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124441438 Original CRISPR TGAAGTAGACGCCATCATCG TGG Intergenic
No off target data available for this crispr