ID: 1124441576

View in Genome Browser
Species Human (GRCh38)
Location 15:29689522-29689544
Sequence ACCCCTCTGGCCCTTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124441576_1124441585 9 Left 1124441576 15:29689522-29689544 CCCACAGCAAGGGCCAGAGGGGT No data
Right 1124441585 15:29689554-29689576 GGGGAAGACCAGGCCCTTCAGGG No data
1124441576_1124441586 16 Left 1124441576 15:29689522-29689544 CCCACAGCAAGGGCCAGAGGGGT No data
Right 1124441586 15:29689561-29689583 ACCAGGCCCTTCAGGGCTCATGG No data
1124441576_1124441590 29 Left 1124441576 15:29689522-29689544 CCCACAGCAAGGGCCAGAGGGGT No data
Right 1124441590 15:29689574-29689596 GGGCTCATGGCCCCAGCCCATGG No data
1124441576_1124441582 -1 Left 1124441576 15:29689522-29689544 CCCACAGCAAGGGCCAGAGGGGT No data
Right 1124441582 15:29689544-29689566 TACATGACCAGGGGAAGACCAGG No data
1124441576_1124441584 8 Left 1124441576 15:29689522-29689544 CCCACAGCAAGGGCCAGAGGGGT No data
Right 1124441584 15:29689553-29689575 AGGGGAAGACCAGGCCCTTCAGG No data
1124441576_1124441581 -10 Left 1124441576 15:29689522-29689544 CCCACAGCAAGGGCCAGAGGGGT No data
Right 1124441581 15:29689535-29689557 CCAGAGGGGTACATGACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124441576 Original CRISPR ACCCCTCTGGCCCTTGCTGT GGG (reversed) Intergenic
No off target data available for this crispr