ID: 1124441580

View in Genome Browser
Species Human (GRCh38)
Location 15:29689535-29689557
Sequence CCCCTGGTCATGTACCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124441580_1124441584 -5 Left 1124441580 15:29689535-29689557 CCAGAGGGGTACATGACCAGGGG No data
Right 1124441584 15:29689553-29689575 AGGGGAAGACCAGGCCCTTCAGG No data
1124441580_1124441586 3 Left 1124441580 15:29689535-29689557 CCAGAGGGGTACATGACCAGGGG No data
Right 1124441586 15:29689561-29689583 ACCAGGCCCTTCAGGGCTCATGG No data
1124441580_1124441590 16 Left 1124441580 15:29689535-29689557 CCAGAGGGGTACATGACCAGGGG No data
Right 1124441590 15:29689574-29689596 GGGCTCATGGCCCCAGCCCATGG No data
1124441580_1124441585 -4 Left 1124441580 15:29689535-29689557 CCAGAGGGGTACATGACCAGGGG No data
Right 1124441585 15:29689554-29689576 GGGGAAGACCAGGCCCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124441580 Original CRISPR CCCCTGGTCATGTACCCCTC TGG (reversed) Intergenic
No off target data available for this crispr