ID: 1124441586

View in Genome Browser
Species Human (GRCh38)
Location 15:29689561-29689583
Sequence ACCAGGCCCTTCAGGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124441577_1124441586 15 Left 1124441577 15:29689523-29689545 CCACAGCAAGGGCCAGAGGGGTA No data
Right 1124441586 15:29689561-29689583 ACCAGGCCCTTCAGGGCTCATGG No data
1124441580_1124441586 3 Left 1124441580 15:29689535-29689557 CCAGAGGGGTACATGACCAGGGG No data
Right 1124441586 15:29689561-29689583 ACCAGGCCCTTCAGGGCTCATGG No data
1124441576_1124441586 16 Left 1124441576 15:29689522-29689544 CCCACAGCAAGGGCCAGAGGGGT No data
Right 1124441586 15:29689561-29689583 ACCAGGCCCTTCAGGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124441586 Original CRISPR ACCAGGCCCTTCAGGGCTCA TGG Intergenic
No off target data available for this crispr