ID: 1124442612

View in Genome Browser
Species Human (GRCh38)
Location 15:29698246-29698268
Sequence CTGTGTACACAGATGCATCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124442612_1124442615 4 Left 1124442612 15:29698246-29698268 CCCGGATGCATCTGTGTACACAG No data
Right 1124442615 15:29698273-29698295 CTGGTTTGCTTTCTGCAAATTGG No data
1124442612_1124442617 22 Left 1124442612 15:29698246-29698268 CCCGGATGCATCTGTGTACACAG No data
Right 1124442617 15:29698291-29698313 ATTGGACGGAAAACAGAGCCTGG No data
1124442612_1124442616 8 Left 1124442612 15:29698246-29698268 CCCGGATGCATCTGTGTACACAG No data
Right 1124442616 15:29698277-29698299 TTTGCTTTCTGCAAATTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124442612 Original CRISPR CTGTGTACACAGATGCATCC GGG (reversed) Intergenic
No off target data available for this crispr