ID: 1124442617

View in Genome Browser
Species Human (GRCh38)
Location 15:29698291-29698313
Sequence ATTGGACGGAAAACAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124442613_1124442617 21 Left 1124442613 15:29698247-29698269 CCGGATGCATCTGTGTACACAGC No data
Right 1124442617 15:29698291-29698313 ATTGGACGGAAAACAGAGCCTGG No data
1124442612_1124442617 22 Left 1124442612 15:29698246-29698268 CCCGGATGCATCTGTGTACACAG No data
Right 1124442617 15:29698291-29698313 ATTGGACGGAAAACAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124442617 Original CRISPR ATTGGACGGAAAACAGAGCC TGG Intergenic
No off target data available for this crispr