ID: 1124453844

View in Genome Browser
Species Human (GRCh38)
Location 15:29822493-29822515
Sequence GAGCATGCCCGGCCCGGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124453828_1124453844 26 Left 1124453828 15:29822444-29822466 CCGGCGCCGGCAACTCAGCGGCC 0: 1
1: 0
2: 0
3: 2
4: 136
Right 1124453844 15:29822493-29822515 GAGCATGCCCGGCCCGGCGGGGG 0: 1
1: 0
2: 0
3: 11
4: 140
1124453829_1124453844 20 Left 1124453829 15:29822450-29822472 CCGGCAACTCAGCGGCCACGCAA 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1124453844 15:29822493-29822515 GAGCATGCCCGGCCCGGCGGGGG 0: 1
1: 0
2: 0
3: 11
4: 140
1124453832_1124453844 5 Left 1124453832 15:29822465-29822487 CCACGCAAACCTGCCGGCCCGGC 0: 1
1: 0
2: 0
3: 1
4: 66
Right 1124453844 15:29822493-29822515 GAGCATGCCCGGCCCGGCGGGGG 0: 1
1: 0
2: 0
3: 11
4: 140
1124453834_1124453844 -8 Left 1124453834 15:29822478-29822500 CCGGCCCGGCCCACTGAGCATGC 0: 1
1: 0
2: 2
3: 31
4: 295
Right 1124453844 15:29822493-29822515 GAGCATGCCCGGCCCGGCGGGGG 0: 1
1: 0
2: 0
3: 11
4: 140
1124453833_1124453844 -4 Left 1124453833 15:29822474-29822496 CCTGCCGGCCCGGCCCACTGAGC 0: 1
1: 0
2: 3
3: 25
4: 318
Right 1124453844 15:29822493-29822515 GAGCATGCCCGGCCCGGCGGGGG 0: 1
1: 0
2: 0
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124453844 Original CRISPR GAGCATGCCCGGCCCGGCGG GGG Exonic
901529028 1:9842244-9842266 GAGCAAGCCCCGCCCGGCCCTGG + Intergenic
904471911 1:30741408-30741430 CACCATGCCCGGCCCCGTGGAGG + Intronic
904642007 1:31938131-31938153 CACCCGGCCCGGCCCGGCGGCGG + Exonic
906961423 1:50421491-50421513 CAGCGTGCCCGGCGCGGCGACGG - Exonic
907484016 1:54764490-54764512 GCGCTGGCCCGGCACGGCGGTGG - Exonic
919188224 1:194182001-194182023 TAGCATGCCCGGTCCAGCTGTGG + Intergenic
919738997 1:200971427-200971449 GGGCATCCCCGGCCCGGGGGTGG + Intronic
920674607 1:208030403-208030425 GAGCATCCCCGGCCCAGCGCTGG - Intronic
921569788 1:216764555-216764577 CACCATGCCCGGCCCAGGGGGGG + Intronic
922496737 1:226063026-226063048 GAGCAGGCTCGGCGCCGCGGCGG - Intronic
1065483832 10:26217785-26217807 GAGGGAGCCGGGCCCGGCGGAGG + Intronic
1067118663 10:43455727-43455749 GAGCACGCCGAGCCCGCCGGAGG + Intronic
1070768395 10:79069203-79069225 GAGCCTGCCCTACCCGGCGGTGG + Exonic
1074116046 10:110458113-110458135 GAGCATCCCCAGCCCGAGGGAGG - Intergenic
1076311946 10:129514896-129514918 GAGCATGCCCCACCCGGAGATGG + Intronic
1076746739 10:132518300-132518322 GAGCAGGGCCGGCCCAGGGGAGG - Intergenic
1079393896 11:20045151-20045173 GATCATGGCCAGGCCGGCGGCGG - Exonic
1081545047 11:44065960-44065982 TGGCAGACCCGGCCCGGCGGCGG + Intronic
1081998259 11:47378111-47378133 GAGCATGCCCTGGCGGGCTGAGG - Intronic
1083890240 11:65592347-65592369 GCGCAGGCCCGGGGCGGCGGCGG - Exonic
1095098506 12:38160222-38160244 GACCATCCCTGGCCCGGCGCAGG - Intergenic
1095441043 12:42238611-42238633 GAGCATCCCCTGCCAGTCGGTGG - Intronic
1096071441 12:48777577-48777599 GAGGATGCCCAGCAGGGCGGGGG - Intronic
1097221991 12:57456481-57456503 GAGCAGGCCGGGCCAGGAGGAGG + Exonic
1099014131 12:77324959-77324981 GGGGAGGCGCGGCCCGGCGGAGG + Intergenic
1101605951 12:106247846-106247868 GGGCATGGCGGGCGCGGCGGCGG + Exonic
1101737074 12:107471014-107471036 GAGCATGCCAGGCACGAAGGGGG + Intronic
1103362437 12:120361997-120362019 CAGCAGGCCCGGCTCGGCTGCGG - Intronic
1103415458 12:120739520-120739542 GAGACTGGGCGGCCCGGCGGGGG + Exonic
1103649644 12:122422642-122422664 GCGCCCGCCCGGCCCCGCGGCGG - Intergenic
1103852634 12:123943314-123943336 GAGCAGGCCCGGGCAGGCGGGGG - Intronic
1104017745 12:124971809-124971831 GAGCATGCAGGGCCCGGGTGGGG - Intronic
1104101810 12:125619651-125619673 CACCATGCCCGGCCCTGCTGTGG + Intronic
1105982751 13:25535527-25535549 GAGCATGCCCGGCCTGGAAATGG - Intronic
1107133461 13:36920136-36920158 GCGCCTGCAGGGCCCGGCGGCGG + Exonic
1111028906 13:82570275-82570297 GGGCATGCCTGGCCCAGCTGTGG - Intergenic
1115096958 14:29648940-29648962 CACCATGCCCGGCCTGGCTGGGG + Intronic
1121091838 14:91188277-91188299 GTGCATGCCAGGCCCAGAGGTGG + Intronic
1121243006 14:92443303-92443325 GGGCATGCCCTGCACTGCGGGGG + Intronic
1122602718 14:102929544-102929566 CAGCAAGCAGGGCCCGGCGGGGG - Intronic
1122717935 14:103706608-103706630 GAGCATACCTGGCCTGGCGGCGG + Intronic
1122917542 14:104865835-104865857 GAGGCGGCCGGGCCCGGCGGGGG - Intronic
1122953496 14:105059138-105059160 GGGCAGGGCCGGCCCGGCTGCGG + Intronic
1123024931 14:105420019-105420041 GGCCATGTCCGGGCCGGCGGCGG - Exonic
1124453844 15:29822493-29822515 GAGCATGCCCGGCCCGGCGGGGG + Exonic
1133079162 16:3305145-3305167 GAGCACGGCCGGCCGGGCCGCGG + Intronic
1134290782 16:12901802-12901824 GAGCGCGCCCGGCCGGGCGGGGG - Exonic
1135570364 16:23544662-23544684 CAGCAGGACCGCCCCGGCGGGGG + Exonic
1137617328 16:49855710-49855732 GAGCGAGCGAGGCCCGGCGGAGG - Intronic
1138619076 16:58197718-58197740 CGCCATGCCCGGCCCGGCCGCGG - Exonic
1139291739 16:65864642-65864664 GAGCATGCCCAGCCCAGCTTCGG + Intergenic
1139528476 16:67530232-67530254 GGCCAGGCCCGGCCCGGGGGAGG + Intronic
1139917794 16:70438961-70438983 GAGCATGGCCCGCGCGGCGCCGG - Intronic
1141922200 16:87143743-87143765 CAGCATGCGAGGCCGGGCGGAGG + Intronic
1143327420 17:6108591-6108613 AAGCATGCCAGGCCCGGTGCTGG + Intronic
1143676363 17:8435974-8435996 GGGCCTGGCCGGGCCGGCGGAGG + Exonic
1148021700 17:44557741-44557763 GAACTGGGCCGGCCCGGCGGCGG - Exonic
1150267870 17:63842564-63842586 CAGCATGCCGGGTCCCGCGGGGG + Exonic
1150488905 17:65561326-65561348 GAGGGGGCCCGGCCAGGCGGAGG - Intronic
1152924132 17:83079812-83079834 GAGCATGCGGGGCGCGGCGCGGG + Exonic
1153480699 18:5543691-5543713 GCGCAGGCTCGGCCCGGTGGGGG + Intronic
1155152725 18:23135605-23135627 GAGCATGGCCCGCCCGCGGGGGG + Intronic
1156338129 18:36187536-36187558 GGCCATGGCCGGCGCGGCGGCGG + Exonic
1157842105 18:50968175-50968197 GATCAGGCACGGCCCGGCGCTGG + Intronic
1158963390 18:62604298-62604320 GAACATGCCCGCTCTGGCGGAGG + Intergenic
1160024095 18:75204694-75204716 GCGCAGGCCCGGCGCCGCGGTGG + Intronic
1160210118 18:76870830-76870852 GAGCCTGCCCGGCGGGGCTGCGG + Intronic
1160903391 19:1440403-1440425 AAGCATGGCCGGCCCGGCATCGG + Exonic
1161224352 19:3136254-3136276 CAGGAAGCCCGGCTCGGCGGTGG - Exonic
1161395810 19:4044301-4044323 GAGCAGGCCCGGCCTGGCATGGG - Intergenic
1161802658 19:6424592-6424614 GCGCCTGGCGGGCCCGGCGGAGG + Exonic
1164992198 19:32692438-32692460 CAGGAGGCCAGGCCCGGCGGTGG - Exonic
1167622626 19:50567972-50567994 CAGCATGCCCGGCCCGTGGGGGG + Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
925024263 2:595294-595316 GAGCATCCCCTGCCTGGCCGGGG + Intergenic
925457088 2:4024845-4024867 GAGCATCCCCTGCCCGGCCCTGG - Intergenic
925990353 2:9249728-9249750 AGGCATGCCCGGGCTGGCGGGGG + Intronic
927631414 2:24777416-24777438 GAGCATGCCTGGCCCTCAGGTGG + Intergenic
928395370 2:30939557-30939579 GAGAATGCCAGGCCCGGAAGGGG + Intronic
929545230 2:42851254-42851276 GTGCATGGCCTGCCTGGCGGAGG + Intergenic
929720372 2:44361881-44361903 GCGCATGCCTGGTCCGGTGGAGG + Intergenic
931301956 2:60988929-60988951 GCGCATGCCTGGCCAGGTGGTGG - Intronic
932087665 2:68776143-68776165 GAGCATGTCTGGCCTGGCTGCGG + Intronic
932728314 2:74198842-74198864 GAACATCTCCGCCCCGGCGGTGG + Intronic
936151188 2:110023235-110023257 GAGCATCCAGGGCCCGGCTGCGG + Intergenic
936193487 2:110348134-110348156 GAGCATCCAGGGCCCGGCTGCGG - Intergenic
936954987 2:118014145-118014167 GCGCATGCTCTGCCCGGCTGCGG - Intergenic
937294207 2:120799915-120799937 GAGCATCCCCGCCCCTGAGGGGG - Intronic
938440889 2:131331301-131331323 GCGCAGGCCTGGCCTGGCGGAGG + Intronic
944553265 2:200864722-200864744 GTGCATGACCCGCCCCGCGGCGG - Intronic
946313999 2:218897651-218897673 GCGCAGACCCGGCCTGGCGGAGG - Intronic
947740444 2:232482512-232482534 GACCCTGCCCCGCCCGGCGTAGG + Intronic
947792501 2:232876191-232876213 GAGAAGGGCCGGCCAGGCGGGGG + Intronic
1168908385 20:1425274-1425296 GAGCAGGCCTGGCCAGGGGGTGG - Intergenic
1169088166 20:2840167-2840189 GCGCATGCGCGGGACGGCGGCGG - Intronic
1171189007 20:23145106-23145128 GAGCATGACCGGGCGGGCTGAGG + Intergenic
1173397630 20:42694971-42694993 GATCATGCATGGCCAGGCGGGGG + Intronic
1178327896 21:31660061-31660083 GCGCAGGCCCAGCCCCGCGGCGG - Intronic
1179674990 21:42974973-42974995 GATCAGGCCCAGCGCGGCGGCGG - Intronic
1180081931 21:45491061-45491083 GAGCCTGCCCTGCCTGGCAGGGG + Intronic
1180871697 22:19150278-19150300 CGCCATGCCCGGCCCGGCCGGGG + Exonic
1183386679 22:37519182-37519204 GGCCATGCCGGGCCGGGCGGAGG - Exonic
1184275350 22:43406596-43406618 GACCATGCCCTGCCAGGCCGAGG - Intergenic
1184523787 22:45009821-45009843 GAGCATGGCCCCCCCGGCGCCGG + Intronic
950426174 3:12925878-12925900 GAGCAGGCCCTGCCCCGCTGTGG + Intronic
950548106 3:13650744-13650766 GTGCAGGCCAGGCCCGGCCGGGG + Intergenic
954256523 3:49411565-49411587 CACCAGGCCCGGCCGGGCGGGGG + Intronic
958592500 3:96175671-96175693 GGGCATGCCCGGCCCAGGCGTGG + Intergenic
962520759 3:136195880-136195902 GGGCAAGCCCGGCCGGGCCGCGG + Intronic
965571947 3:170181744-170181766 GCGCATGCGCCCCCCGGCGGCGG + Exonic
966594321 3:181712327-181712349 GCGCGGGCCCGGCCCGCCGGCGG - Exonic
968775448 4:2537011-2537033 CGGCAAGGCCGGCCCGGCGGCGG + Intronic
969724291 4:8910297-8910319 GAGCACTCCCGGCCAGGCCGCGG - Intergenic
984462743 4:180058234-180058256 GAGCCCGCCCCGCCCGGCTGTGG + Intergenic
985661958 5:1161846-1161868 GCAGATGCCCGGCCCTGCGGCGG - Intergenic
985988387 5:3536076-3536098 GCGCATGCGCGGCCTGCCGGGGG - Intergenic
986726463 5:10601707-10601729 GAGCATGCCCCGCAGGGAGGAGG - Intronic
992529897 5:77643764-77643786 GGGCATGCCAGGCGCTGCGGAGG + Intergenic
1000338874 5:160261680-160261702 GAGCATTCCCAGCCCGGGGAGGG - Intronic
1002926896 6:1610189-1610211 GAGAAGGCCGGGCCCGGCCGCGG - Exonic
1003290741 6:4776489-4776511 CAGCCCGCCCGGCCCCGCGGCGG + Exonic
1003840382 6:10113392-10113414 GCGCAGGCCTGGCCCAGCGGGGG + Intronic
1005931693 6:30489638-30489660 GAGAGGGGCCGGCCCGGCGGGGG + Intronic
1006440840 6:34052707-34052729 GAGCATGCCTGGGCTGGCTGAGG + Intronic
1009431559 6:63572271-63572293 GAGCATCCCCGGGGCGGGGGAGG - Exonic
1012475781 6:99613761-99613783 GAGCAGGGCAGGCCAGGCGGCGG - Exonic
1013793686 6:113860428-113860450 GGGCGCGCCGGGCCCGGCGGCGG - Exonic
1016865463 6:148761625-148761647 GAGAATGCCCGGCAGGGCTGAGG + Intronic
1019814457 7:3189472-3189494 GAGGATGCCCTCCCTGGCGGGGG + Intergenic
1020100726 7:5393033-5393055 GAGCCAGCCCTGCCCGGGGGAGG - Intronic
1021807812 7:24374292-24374314 CAGCATGCCCGGCCTGGCATTGG + Intergenic
1023564386 7:41509065-41509087 GAGCATGCCAGGCCAGGAAGAGG - Intergenic
1027200869 7:76063177-76063199 GAGGATGCCAGGCCCGGGGGGGG + Intronic
1027672487 7:81118935-81118957 GAGCATGCCCAGCCCAGGTGTGG - Intergenic
1028020797 7:85768604-85768626 GAGCATGCCTGGCCCAGCCATGG + Intergenic
1033556171 7:142490094-142490116 GAGCATGCCAGGCCATGCAGTGG + Intergenic
1033558535 7:142509540-142509562 GAGCATGCCAGGCCATGCAGTGG + Intergenic
1036490749 8:9223163-9223185 CACCATGCCCGGCCAGGAGGTGG + Intergenic
1043527499 8:81112223-81112245 GAGCAAGCCAGGCCCCGCGCCGG - Intergenic
1048906830 8:139096683-139096705 GAGCATGCCTGGCTCTGCAGGGG + Intergenic
1049283128 8:141760655-141760677 GAGCAGTCCCCACCCGGCGGTGG + Intergenic
1049408975 8:142464095-142464117 GGGCAGGGCCGGCCCGGTGGGGG - Exonic
1051235369 9:14993367-14993389 GCGCAGGCCCGGCGCGGGGGCGG + Intergenic
1059483669 9:114611395-114611417 GAGCGGGGCCGGCCGGGCGGGGG + Exonic
1061453517 9:130681681-130681703 GAGCGCGCGGGGCCCGGCGGGGG - Exonic
1062287756 9:135780688-135780710 GAGCCTGCCCTGCCCAGCGTCGG + Intronic
1185447614 X:267801-267823 CACCACGCCCGGCCCGGCGACGG + Intergenic
1187067398 X:15854561-15854583 GAGCCTGCCCGGCCCGCCACTGG - Intronic
1190308658 X:49101468-49101490 GAGCATGCCGGGCCCCGCGCGGG + Intergenic
1192584672 X:72309545-72309567 GAACATGCCAGGCCCAGCGCTGG - Intergenic
1195625208 X:106999899-106999921 GGGCTGGCCCGGCCCGGCGGCGG - Exonic
1200092926 X:153644246-153644268 GCGCTGGCCCGGCCCGGCGGAGG + Intronic