ID: 1124453852

View in Genome Browser
Species Human (GRCh38)
Location 15:29822506-29822528
Sequence TCGTCCAGCCCCGCCCCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 203}

Found 20 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124453852_1124453861 3 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453861 15:29822532-29822554 GAGGCGAGGCGAGGCGGGGAGGG 0: 1
1: 4
2: 21
3: 256
4: 1714
1124453852_1124453860 2 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453860 15:29822531-29822553 CGAGGCGAGGCGAGGCGGGGAGG 0: 2
1: 14
2: 27
3: 253
4: 981
1124453852_1124453858 -2 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453858 15:29822527-29822549 GAGGCGAGGCGAGGCGAGGCGGG 0: 2
1: 11
2: 29
3: 104
4: 1125
1124453852_1124453870 21 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453870 15:29822550-29822572 GAGGGGGCGGGGCCGCGGCGGGG 0: 1
1: 4
2: 58
3: 354
4: 1893
1124453852_1124453875 28 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453875 15:29822557-29822579 CGGGGCCGCGGCGGGGGAGGGGG 0: 1
1: 1
2: 22
3: 338
4: 2511
1124453852_1124453864 8 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453864 15:29822537-29822559 GAGGCGAGGCGGGGAGGGGGCGG 0: 1
1: 0
2: 53
3: 562
4: 4083
1124453852_1124453863 5 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453863 15:29822534-29822556 GGCGAGGCGAGGCGGGGAGGGGG 0: 1
1: 2
2: 27
3: 246
4: 1442
1124453852_1124453868 19 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453868 15:29822548-29822570 GGGAGGGGGCGGGGCCGCGGCGG 0: 1
1: 5
2: 69
3: 532
4: 3091
1124453852_1124453857 -3 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453857 15:29822526-29822548 CGAGGCGAGGCGAGGCGAGGCGG 0: 3
1: 5
2: 26
3: 78
4: 909
1124453852_1124453872 25 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453872 15:29822554-29822576 GGGCGGGGCCGCGGCGGGGGAGG 0: 4
1: 5
2: 130
3: 724
4: 3746
1124453852_1124453874 27 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453874 15:29822556-29822578 GCGGGGCCGCGGCGGGGGAGGGG 0: 2
1: 3
2: 24
3: 290
4: 2188
1124453852_1124453869 20 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453869 15:29822549-29822571 GGAGGGGGCGGGGCCGCGGCGGG 0: 1
1: 7
2: 70
3: 510
4: 2661
1124453852_1124453859 -1 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453859 15:29822528-29822550 AGGCGAGGCGAGGCGAGGCGGGG 0: 9
1: 23
2: 92
3: 286
4: 4845
1124453852_1124453862 4 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453862 15:29822533-29822555 AGGCGAGGCGAGGCGGGGAGGGG 0: 1
1: 5
2: 39
3: 325
4: 3293
1124453852_1124453856 -6 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453856 15:29822523-29822545 GGACGAGGCGAGGCGAGGCGAGG 0: 1
1: 2
2: 36
3: 98
4: 753
1124453852_1124453867 16 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453867 15:29822545-29822567 GCGGGGAGGGGGCGGGGCCGCGG 0: 2
1: 21
2: 128
3: 771
4: 3958
1124453852_1124453865 9 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453865 15:29822538-29822560 AGGCGAGGCGGGGAGGGGGCGGG 0: 1
1: 2
2: 29
3: 301
4: 2157
1124453852_1124453871 22 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453871 15:29822551-29822573 AGGGGGCGGGGCCGCGGCGGGGG 0: 1
1: 3
2: 47
3: 338
4: 2073
1124453852_1124453873 26 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453873 15:29822555-29822577 GGCGGGGCCGCGGCGGGGGAGGG 0: 2
1: 3
2: 27
3: 276
4: 1900
1124453852_1124453866 10 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453866 15:29822539-29822561 GGCGAGGCGGGGAGGGGGCGGGG 0: 1
1: 3
2: 68
3: 519
4: 3023

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124453852 Original CRISPR TCGTCCAGCCCCGCCCCCGC CGG (reversed) Intronic
900414646 1:2529436-2529458 TCGTCGGGCCGCGCGCCCGCAGG + Exonic
901059664 1:6466168-6466190 GCCTTCAGCCCCGCGCCCGCAGG + Exonic
901085994 1:6613087-6613109 CGGTCCAGTCCCGGCCCCGCGGG + Intronic
901696547 1:11012298-11012320 CCGCCCCGCCCCGCCCTCGCTGG + Intergenic
902585628 1:17437687-17437709 CCGTCAGGCCCCGCCCCCCCCGG + Intronic
903420960 1:23217542-23217564 TCCTCCAGCTCCTCCCTCGCCGG + Intergenic
903961045 1:27058087-27058109 TCCTCCAGCCCCGCCCGCACAGG + Intergenic
904194542 1:28775309-28775331 CCGCCAAGCCCGGCCCCCGCAGG - Intergenic
904754290 1:32759623-32759645 GTGTCCAGCCCCACCCCAGCAGG - Intronic
905647211 1:39633049-39633071 CGGCCCAGCCCCGCCGCCGCCGG - Intronic
905863744 1:41366041-41366063 TCTTCCAGCCCCACCCCACCTGG - Intronic
906087375 1:43147761-43147783 TCGCCCCGCCCCGCGCCCGCCGG - Intronic
906168953 1:43707755-43707777 CCGCCCCGCCCCTCCCCCGCCGG + Intronic
906572316 1:46853731-46853753 TTGACCAGCCCCTCCCCCACTGG + Intergenic
906599463 1:47112178-47112200 TTGACCAGCCCCTCCCCCACTGG - Intronic
906769624 1:48472210-48472232 TCTTCCGGCCCCGCCCCTCCTGG - Intergenic
907689230 1:56645562-56645584 CCGCCGAGCCCCGCGCCCGCCGG - Intronic
907896827 1:58700149-58700171 TCGTCCGGCCCCTCCCGTGCCGG + Intergenic
908572060 1:65420595-65420617 ACGCAGAGCCCCGCCCCCGCCGG - Exonic
913144525 1:115976507-115976529 GCTTCCATCCCCGCCCCGGCGGG + Exonic
922950451 1:229554770-229554792 TCATCCATCCCAGCCCCCACAGG + Intronic
1066049390 10:31620290-31620312 TAGTCATGCCCCGCCCCAGCTGG + Intergenic
1067080711 10:43210823-43210845 TCTTCCAGGCCAGCCCCAGCTGG - Intronic
1071997550 10:91162967-91162989 CTGCCCCGCCCCGCCCCCGCCGG + Intergenic
1072218854 10:93310567-93310589 TCGTCCCGCCCCTTCCCGGCTGG + Exonic
1075654762 10:124153443-124153465 GCTTCCAGCCCAGCGCCCGCAGG - Intergenic
1076710547 10:132331683-132331705 TCGAGCAGCCCCGCCCGCCCCGG + Intronic
1076900686 10:133336096-133336118 GGGTCCCGCCCAGCCCCCGCGGG + Intronic
1077032392 11:474378-474400 TCACCCACCCCCGCCCCCTCTGG - Intronic
1077105920 11:842640-842662 TCCACCGGCCCCGCCACCGCTGG + Intergenic
1077170906 11:1165295-1165317 TCGTCAAGCACCGTCCCTGCAGG - Exonic
1077204652 11:1336682-1336704 CCGCCCCGCCCCGCCCTCGCCGG - Intergenic
1077391110 11:2301036-2301058 CCGTCCAGCCCAGCACCCCCAGG - Intronic
1077495790 11:2885961-2885983 GCGCCCCGCCCCGCCCCCGGTGG - Intergenic
1077613551 11:3659822-3659844 CCGTCCATCCCCGCCACCCCTGG + Exonic
1083457112 11:62786694-62786716 TCCTCCGGCCCCGCGCCCCCTGG - Exonic
1083807529 11:65084000-65084022 TCCTCCAGCGCCGCCGCCCCGGG + Exonic
1083886136 11:65574325-65574347 GCCCCCAGCCCCGCCCCGGCGGG - Intergenic
1084174287 11:67415601-67415623 CCGCCCCGCGCCGCCCCCGCTGG + Intronic
1084265614 11:68003870-68003892 CCGGCCCGCCCCGCCCCCGCCGG + Intronic
1085047572 11:73362479-73362501 ACGTCCAGCTCCGGCCCGGCGGG - Exonic
1090208004 11:124896417-124896439 CCGTCCAGCCCCGCATCCTCCGG - Intronic
1090606222 11:128425211-128425233 CAGTCCAGCCCCACCCACGCTGG + Intergenic
1094048757 12:26196111-26196133 GCGTCCAGCCCTGCCCCGCCCGG - Intronic
1098595846 12:72272609-72272631 TCCTCCTCCCCCGCCCCCTCTGG - Intronic
1100844513 12:98645007-98645029 TCGTCCTGCCCCTCCTCCTCGGG - Exonic
1101837080 12:108303237-108303259 TCGTCGAGCCCAGCCCCTGCTGG + Intronic
1102394618 12:112575401-112575423 GCGTCCGGCCGCGCCCCCACGGG - Intronic
1105578055 13:21671086-21671108 TCCTCCTGCGCAGCCCCCGCCGG - Intergenic
1113640285 13:111952466-111952488 TCATCCAGCCCTGTCCCAGCAGG - Intergenic
1114051150 14:18920578-18920600 TCCACCACCCCCGCCACCGCAGG - Intergenic
1114111412 14:19481347-19481369 TCCACCACCCCCGCCACCGCAGG + Intergenic
1116958042 14:50944088-50944110 TCGTCCCGCCCGGCCGCGGCCGG + Intronic
1117913872 14:60657347-60657369 TCCTCCGGCCGCGCCGCCGCCGG - Intronic
1118324116 14:64769872-64769894 TCCGCCAGCCCAGCCCCAGCAGG + Intronic
1121226338 14:92324075-92324097 TCATCCAGTCCCCTCCCCGCCGG + Intronic
1122214502 14:100193947-100193969 ACCCCCACCCCCGCCCCCGCAGG - Intergenic
1122550044 14:102544711-102544733 TCCTCCAGCCCCGACCCGGCAGG - Intergenic
1122715921 14:103696987-103697009 TCGGCCGGCCCCGCCCATGCTGG - Intergenic
1122910761 14:104826678-104826700 TCCGGCAGCCCCGCCCCCTCCGG - Intergenic
1122910770 14:104826696-104826718 TCCGGCAGCCCCGCCCCCTCCGG - Intergenic
1123021151 14:105398520-105398542 ACGGCAAGCCCCGCCCCCACCGG - Intergenic
1124453852 15:29822506-29822528 TCGTCCAGCCCCGCCCCCGCCGG - Intronic
1125181993 15:36888394-36888416 TCTCCCAGCCCCGGCCCCGACGG + Intergenic
1127606566 15:60592678-60592700 GCGCCCCGCCCCGCCCCCGCGGG + Intronic
1128526247 15:68414309-68414331 CCCTCCAGCCCCGTCCCCCCAGG - Intronic
1129854037 15:78811539-78811561 TGGCCCCGCCCCGCCCCGGCCGG + Intronic
1130955055 15:88621585-88621607 ACGACCAGCGCCGCCCCCTCTGG - Intronic
1132426829 15:101724598-101724620 CCGCCCCGCCCCGCCCCTGCAGG - Exonic
1132426849 15:101724643-101724665 CCGCCCCGCCCCGCCCCTGCAGG - Intergenic
1132550463 16:551909-551931 TCTTGCAGCCCGGCCCCCGGGGG - Intronic
1132598030 16:762072-762094 TGGCCCAGCCCCGCCCCACCTGG + Intronic
1132671862 16:1105367-1105389 TCCTCCAGCCTGGCCACCGCTGG - Intergenic
1132865449 16:2090849-2090871 GCGCCCAGCCCCGCGCCCACCGG + Intronic
1132878669 16:2151446-2151468 AGGTCCAGCCCAGCCCCTGCAGG - Intronic
1135250934 16:20900558-20900580 TGGTCCAGCCCAGCTCCCTCCGG - Intronic
1136399915 16:30011559-30011581 TCTTCACGCCCCTCCCCCGCAGG + Intronic
1137426532 16:48385256-48385278 TCGCCAACCCCCGCCACCGCGGG + Intronic
1138179753 16:54933253-54933275 TCCGCCAGCCGCGCCGCCGCTGG - Exonic
1139796425 16:69486516-69486538 TCTTCCAGCCCCGACCTTGCTGG - Intergenic
1139937169 16:70579824-70579846 TGGCCCTGCCCCGCCCCTGCTGG + Intergenic
1142417125 16:89948995-89949017 CCTCCCAGCCCCGACCCCGCCGG - Intronic
1142417184 16:89949115-89949137 CCTCCCAGCCCCGTCCCCGCCGG - Intronic
1142671186 17:1488102-1488124 TCCTCTGGCCGCGCCCCCGCTGG - Intronic
1142679784 17:1539990-1540012 GCCTCCCGCCCAGCCCCCGCTGG + Intronic
1143078869 17:4366717-4366739 GCCTCCCGCCCCGCCCCCGGCGG + Intergenic
1143150861 17:4807126-4807148 TCGGCCGGCCCCGCCTCGGCCGG + Exonic
1143390504 17:6556657-6556679 GCGCCCAACGCCGCCCCCGCGGG + Intergenic
1144078176 17:11737512-11737534 TTGTCCAGCCCGGCCCCAGAAGG - Intronic
1144515902 17:15917545-15917567 CTGCCCAGCCCTGCCCCCGCAGG + Intergenic
1144787492 17:17840175-17840197 CAGACCAGCCCCGCCCCCGCGGG + Intergenic
1147158948 17:38559691-38559713 TCGGCCAGCAGCACCCCCGCAGG - Exonic
1147285943 17:39402351-39402373 GCGTCCGGCCCCGGCCCCCCAGG - Intronic
1149533819 17:57416748-57416770 TCGTCCAGCCCCCCAACCCCAGG - Intronic
1150215842 17:63468653-63468675 ACCTCCAGCCCAGTCCCCGCTGG - Intergenic
1151951086 17:77354522-77354544 TCGTTCAGCCCTCCCCCAGCTGG - Intronic
1152823781 17:82450742-82450764 GCGCGCGGCCCCGCCCCCGCCGG - Intronic
1156444502 18:37225166-37225188 TCGTCCAGCTCTGCCCCATCAGG - Exonic
1160613899 18:80109552-80109574 CCTCCGAGCCCCGCCCCCGCCGG + Intronic
1160769243 19:822716-822738 TCAACCAGCCCCTACCCCGCAGG - Intergenic
1160989437 19:1854466-1854488 GCGCCCAGCCCAGCCCCCGCAGG - Exonic
1161080416 19:2307635-2307657 TCTTCCAGCTCCGCACCCCCAGG + Intronic
1161111883 19:2475337-2475359 TGGCGCGGCCCCGCCCCCGCCGG - Intergenic
1161175812 19:2841676-2841698 CCGTCCTGCGCCGCCCTCGCCGG - Intronic
1161311379 19:3595967-3595989 GCCTCCAGCCCCGCCCGCCCCGG + Intronic
1161327360 19:3670208-3670230 CCGTCCAACCCCGCACCCTCAGG - Intronic
1161337111 19:3720657-3720679 ACGACCAGCCCCGCCCACCCAGG + Intronic
1161393547 19:4033270-4033292 AAGACCAGCCTCGCCCCCGCAGG - Intronic
1162033003 19:7925462-7925484 GCGTCCAGGCCCGCGCCCACCGG + Exonic
1162105381 19:8366866-8366888 TCCTCCCTCCCCGCCCCCGCCGG + Intronic
1162742701 19:12782703-12782725 AGGACCAGCCCCGCCCCGGCCGG + Intronic
1163859287 19:19732760-19732782 GCGTCCTGTCCCGTCCCCGCGGG - Intronic
1164280372 19:23763306-23763328 GCGTCCAGCCCCGTCCGTGCGGG + Intronic
1165097262 19:33416487-33416509 TCGTGCAGCCCCGGACCAGCTGG + Intronic
1165160562 19:33813244-33813266 TCTTCCAACCCCGCCCCAACAGG - Exonic
1165313010 19:35039969-35039991 TCCTCCAGCTCCTGCCCCGCCGG + Intronic
1165739238 19:38195790-38195812 CCGTCCCCCCCCGCCCCCCCGGG + Intronic
1166215331 19:41331020-41331042 CCGCCCCGCCCCGCCCCGGCAGG - Exonic
1167258037 19:48442780-48442802 TCGGCCAGGCCCGCGCCCCCCGG - Exonic
1167428437 19:49441468-49441490 GGGTCCAGCCCCGGCCCGGCCGG + Exonic
924985341 2:264701-264723 ACCTGCAGCCCCGCCCCTGCAGG + Intronic
925305829 2:2847460-2847482 TCGTCCAGCTCCCTCCCTGCAGG + Intergenic
926130920 2:10302780-10302802 TCCTACGGCCCCGCCCCCTCCGG - Intergenic
927751316 2:25673250-25673272 TCCTGCAGCGCCGCACCCGCAGG + Intronic
931253764 2:60553825-60553847 TCGGCCCGCCCCTCCCCCGGGGG - Intergenic
931671753 2:64653976-64653998 CCGCCCGACCCCGCCCCCGCCGG + Intronic
932635607 2:73385742-73385764 TCTTCCGGCCCCGCCCAGGCGGG + Exonic
934518559 2:95004964-95004986 TCCCCCACCCCCACCCCCGCGGG - Intergenic
935396867 2:102619194-102619216 CCCTCCTCCCCCGCCCCCGCAGG - Intergenic
937203848 2:120223434-120223456 CCACCCGGCCCCGCCCCCGCAGG - Intergenic
948212975 2:236208610-236208632 TCCTCCCGCCCCTCCCCCACCGG + Intronic
948402049 2:237691858-237691880 TGGTCCTGCCCCGCCCCTCCCGG - Intronic
1168814579 20:728132-728154 CCCTCCTGCGCCGCCCCCGCGGG - Intergenic
1169198899 20:3698066-3698088 CCGTCCAGCCCCGGCCCCAGCGG + Exonic
1169211734 20:3769547-3769569 GCCTCCACCCCCTCCCCCGCCGG + Intergenic
1171724451 20:28603109-28603131 GCTTCCAGCCGCGCCGCCGCAGG - Intergenic
1172581271 20:36050681-36050703 TCTCCCAGCCCGGACCCCGCCGG - Intergenic
1173821236 20:46021909-46021931 TCGTCCCGCCCGGCCCTGGCAGG - Intronic
1174485958 20:50861404-50861426 TGGTCCAGCCCCTCCACCCCAGG - Intronic
1175806888 20:61834429-61834451 TCTTCCAGCCCGGCCCCCAAGGG + Intronic
1175888022 20:62303170-62303192 CCGCCCGGCCCGGCCCCCGCAGG - Intronic
1176062110 20:63176951-63176973 TCGTCCTTCCCCGCCCCCATCGG - Intergenic
1176223174 20:63979550-63979572 CCGCCCCGCCCCGCCCCAGCCGG + Exonic
1176243004 20:64083741-64083763 CCGCCCCGCCCCGCCCCGGCCGG + Intronic
1176549293 21:8214485-8214507 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1176557186 21:8258708-8258730 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1176568225 21:8397523-8397545 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1176576128 21:8441743-8441765 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1179874686 21:44261949-44261971 CCGCCCCTCCCCGCCCCCGCGGG - Exonic
1180130387 21:45823248-45823270 TCGTCCTCCCCAGCGCCCGCTGG + Intronic
1180145187 21:45914775-45914797 TCTTCCAGGCCAACCCCCGCCGG - Intronic
1180297997 22:10961783-10961805 GCTTCCAGCCGCGCCGCCGCAGG - Intergenic
1180469625 22:15642953-15642975 TCCACCACCCCCGCCACCGCAGG - Intergenic
1181230131 22:21417245-21417267 CGGCCCGGCCCCGCCCCCGCAGG + Intergenic
1181248518 22:21517621-21517643 CGGCCCGGCCCCGCCCCCGCAGG - Intergenic
1181690309 22:24555416-24555438 TCGGCAAGCCCCGCCTCTGCCGG + Intronic
1182429017 22:30289384-30289406 TCTTCCTGCCCCGCCGCAGCCGG - Exonic
1183649440 22:39145642-39145664 GCGCCAGGCCCCGCCCCCGCCGG + Intronic
1183715126 22:39528959-39528981 TCCTCCAGTCCAGCCCCGGCAGG - Intergenic
1183903186 22:41021677-41021699 CCGTCCTGCCCCGCCCCGCCCGG + Intergenic
1184728953 22:46362813-46362835 CGGTCCAGCCCCGCCCAGGCGGG - Exonic
1203254178 22_KI270733v1_random:130801-130823 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1203262234 22_KI270733v1_random:175880-175902 CCGCCCACCCCCGCACCCGCCGG - Intergenic
952316843 3:32238912-32238934 GCGTCCAGCCCCAGACCCGCCGG + Exonic
960702344 3:120450916-120450938 CCGTCCTGCCCCGCGCCCCCAGG - Exonic
961049592 3:123735044-123735066 TCATCCAGCCCAGACCCAGCAGG - Intronic
966181732 3:177195292-177195314 TCCTGCAGCCCCTCCCCCACAGG + Intronic
967087462 3:186108424-186108446 TGGTCGACCCCCGCCCCCGCAGG + Intronic
967849554 3:194071420-194071442 GCGTCCCCCTCCGCCCCCGCCGG - Intergenic
968043840 3:195612433-195612455 TCCTCCAGCCCCGCCCCCGCAGG - Intergenic
968230449 3:197002465-197002487 TCACCCGGCCCCGCACCCGCTGG - Exonic
968636724 4:1684621-1684643 GCGTCCTGCCCCGCCGCCTCAGG - Intergenic
969703321 4:8779498-8779520 ACGTCCAGCCCCACCTCTGCAGG + Intergenic
975118366 4:70704535-70704557 TCTTCCTTACCCGCCCCCGCTGG - Intronic
975118417 4:70704671-70704693 TCCTCCAGCCCCTCCCGCCCCGG - Intronic
982380657 4:154744262-154744284 TTGCCCAGCCCGGCCCCTGCCGG + Intronic
985437029 4:189940557-189940579 GCTTCCAGCCGCGCCGCCGCAGG + Intergenic
985491467 5:182150-182172 TCCTCCAGCCCAGCCCACCCGGG + Exonic
987989376 5:25190756-25190778 TCTCCCAGCCCGGCCCCCGCCGG - Intergenic
988941452 5:36151932-36151954 CCGACCAGTCCCGCTCCCGCGGG + Exonic
998157697 5:139795889-139795911 CTGTCCCGCCCCGCCGCCGCCGG - Exonic
998367731 5:141641539-141641561 GCGTCCACCACCTCCCCCGCCGG - Exonic
1000876419 5:166644283-166644305 TCCCCCACCCCCACCCCCGCCGG + Intergenic
1001586004 5:172834309-172834331 TCCGGCCGCCCCGCCCCCGCCGG - Exonic
1001778121 5:174344418-174344440 TCGTCCAGCCCTGCACAGGCAGG - Intergenic
1008527357 6:52420120-52420142 TCGCCCCGCCCCGCTCCCGGAGG - Intergenic
1019329165 7:454267-454289 TCCTCCAGCCCTCCCCCCCCGGG + Intergenic
1019518314 7:1449220-1449242 CCGTCCAGCCCAGCAGCCGCCGG + Intronic
1019520706 7:1459505-1459527 GAGCCCGGCCCCGCCCCCGCCGG + Intergenic
1019735221 7:2647069-2647091 CACTCCAGCCCCGCCCCCTCGGG - Intronic
1024611322 7:51066679-51066701 ACTTCCTGCCCCGACCCCGCTGG + Intronic
1026360877 7:69599757-69599779 CCGGCCAGCCCCGCCGCCGCCGG - Exonic
1029374990 7:100171859-100171881 CCGTCGAGCCCCGCCGCCCCGGG - Exonic
1033099672 7:138460026-138460048 TTGCCCAGCCCCGCCCCCTCCGG - Intergenic
1034490586 7:151391206-151391228 TCGCTGGGCCCCGCCCCCGCAGG - Intronic
1034963064 7:155374283-155374305 CCGCCCGGCCCAGCCCCCGCCGG - Intergenic
1036932736 8:12972288-12972310 CCGGCCAGCCCCGCCTCCACGGG - Intronic
1037666051 8:20971187-20971209 TGTTCCAGCCCCACCCCTGCAGG - Intergenic
1037882367 8:22579396-22579418 TCCTCCAGCCCCCAGCCCGCAGG + Exonic
1043841242 8:85107183-85107205 TCGCCCCGCCCCGCCCCCTCGGG + Exonic
1049373353 8:142278082-142278104 TCCTCCAGCCCCACCCCATCAGG + Intronic
1049614142 8:143568972-143568994 TCGCCCAGCTCCGCCCCTCCAGG - Intronic
1049644333 8:143729323-143729345 CCGTCCTGACCCGCCCCTGCAGG - Exonic
1049672685 8:143876879-143876901 TGGCCCTGCCCCGCCCTCGCTGG - Intronic
1060992689 9:127857830-127857852 TCTTCCAGCCCCTTCCCTGCAGG + Intergenic
1061413426 9:130433003-130433025 ACCTCCAACCCCGCCCCCGCAGG + Intronic
1061479047 9:130887519-130887541 GCGTCCTGCCCTGCCCCCTCGGG + Intronic
1061479243 9:130888461-130888483 TCCACCAGCCCCGGCCCGGCTGG - Intergenic
1061928648 9:133820761-133820783 TCCTCCAGCCCAGCCCCTGAGGG - Intronic
1062319997 9:135986224-135986246 CCCTCCAGCACCGCCCCTGCAGG - Intergenic
1062435793 9:136546092-136546114 CCGCCCGGCCCCACCCCCGCCGG + Intergenic
1062696117 9:137877382-137877404 CCGGCCCGCCCCGTCCCCGCCGG - Intergenic
1203470579 Un_GL000220v1:113945-113967 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1203478400 Un_GL000220v1:157917-157939 CCGCCCACCCCCGCACCCGCCGG - Intergenic
1187055413 X:15737963-15737985 TGCTCTGGCCCCGCCCCCGCCGG - Intronic
1187391222 X:18887634-18887656 CCGCCCCGCCCTGCCCCCGCAGG - Intergenic
1188811482 X:34657533-34657555 GCGCCCAGCCCGGCCCTCGCCGG + Intergenic
1196629994 X:117927262-117927284 TCGCCCCGCCCCGCCCCTCCCGG + Intronic
1200003300 X:153072783-153072805 CTGTCCCGCCCCGCCCCCCCGGG - Intronic
1200004423 X:153077226-153077248 CTGTCCCGCCCCGCCCCCCCGGG + Intergenic