ID: 1124453875

View in Genome Browser
Species Human (GRCh38)
Location 15:29822557-29822579
Sequence CGGGGCCGCGGCGGGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2873
Summary {0: 1, 1: 1, 2: 22, 3: 338, 4: 2511}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124453851_1124453875 29 Left 1124453851 15:29822505-29822527 CCCGGCGGGGGCGGGGCTGGACG 0: 1
1: 1
2: 10
3: 80
4: 601
Right 1124453875 15:29822557-29822579 CGGGGCCGCGGCGGGGGAGGGGG 0: 1
1: 1
2: 22
3: 338
4: 2511
1124453852_1124453875 28 Left 1124453852 15:29822506-29822528 CCGGCGGGGGCGGGGCTGGACGA 0: 1
1: 1
2: 0
3: 15
4: 203
Right 1124453875 15:29822557-29822579 CGGGGCCGCGGCGGGGGAGGGGG 0: 1
1: 1
2: 22
3: 338
4: 2511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124453875 Original CRISPR CGGGGCCGCGGCGGGGGAGG GGG Intronic
Too many off-targets to display for this crispr