ID: 1124455108

View in Genome Browser
Species Human (GRCh38)
Location 15:29835021-29835043
Sequence CCTCATCTGCAGAATGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 680
Summary {0: 1, 1: 2, 2: 13, 3: 128, 4: 536}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124455101_1124455108 21 Left 1124455101 15:29834977-29834999 CCTGATGGAAATAATCTGGAAAA 0: 1
1: 0
2: 2
3: 27
4: 396
Right 1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG 0: 1
1: 2
2: 13
3: 128
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124455108 Original CRISPR CCTCATCTGCAGAATGGAGG AGG Intronic
900081821 1:864229-864251 CCTCCTCTGCACAATGGTGGTGG + Intergenic
900506875 1:3033754-3033776 CCTCAACTGCAGAGCGGAGCTGG - Intergenic
900781969 1:4624296-4624318 CCTCCCCTGCAGCAGGGAGGAGG - Intergenic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902466791 1:16623658-16623680 CCTCAGCTGATGATTGGAGGTGG - Intergenic
902507817 1:16949116-16949138 CCTCAGCTGATGATTGGAGGTGG + Intronic
903125219 1:21243192-21243214 CATCATCTGTAAAATGGAAGAGG + Intronic
903168975 1:21540509-21540531 CCTCACCTGTAAAATGGAGCTGG + Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903338400 1:22639481-22639503 CTTCAGCTGCTGAAGGGAGGGGG + Exonic
903463260 1:23533984-23534006 CCTCATCTTTGAAATGGAGGCGG + Intergenic
903656964 1:24955433-24955455 TTTCATCTCCACAATGGAGGTGG + Intronic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
904035194 1:27555296-27555318 CCTCATCTGTAAAATGGGAGGGG - Intronic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904840268 1:33368011-33368033 CCTCATCTACGGAATGGGGAGGG - Intronic
905073665 1:35250368-35250390 CCACATCAACAGAATGAAGGAGG - Intergenic
905175587 1:36133561-36133583 CCTCATCTGCAGATAGTAGTAGG + Intergenic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905827090 1:41034074-41034096 CCTCATGTGCAAACTGGAGATGG - Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905954158 1:41978249-41978271 CCACAGCTGCTGACTGGAGGGGG - Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906078813 1:43070276-43070298 CCTCATCTGTAAGACGGAGGGGG - Intergenic
906126211 1:43428421-43428443 CTTCAGCAGCAGCATGGAGGAGG + Exonic
906778206 1:48548796-48548818 TTTCATCTGCAAAATGGAGATGG - Intronic
907440488 1:54475414-54475436 CCCCATCTCTACAATGGAGGTGG - Intergenic
907457744 1:54586216-54586238 TCTCATCTGCAGAATGGATGGGG + Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907798077 1:57737457-57737479 CCTCATCTGTTAAATGGTGGTGG + Intronic
907912692 1:58840699-58840721 CCTCACCTGAAGAATGATGGGGG + Intergenic
908002381 1:59693388-59693410 ACTCCTCTGTAAAATGGAGGTGG + Intronic
908040047 1:60102697-60102719 TCTCTCCTCCAGAATGGAGGTGG + Intergenic
908129035 1:61056370-61056392 CCTCATCTGTAGAATTGCAGAGG - Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
913015566 1:114730528-114730550 CTTCATCTGCAATATGGAGCTGG + Exonic
915364690 1:155308425-155308447 CCTCATCTGTTGAATGAGGGTGG - Intergenic
916150655 1:161785800-161785822 CCTCATCAGCAGTATGTAAGAGG + Intronic
916198848 1:162250627-162250649 CCTCAACTGCTGCATGGGGGTGG - Intronic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
916578443 1:166087365-166087387 CCTCCTTTGCAAAATGGAGATGG - Intronic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
917834060 1:178926907-178926929 CCTCATCTGCTGAGTGCATGAGG - Intergenic
918077394 1:181180913-181180935 CCTCCTTTGCAGGATGGAAGTGG - Intergenic
918304154 1:183230610-183230632 CCTCATCTGCAAAATAGAGGGGG + Intronic
919354952 1:196510318-196510340 CCTAATCTGTATAATGGAGGTGG - Intronic
920199241 1:204249363-204249385 CCTCAGCAGGAGAAAGGAGGGGG - Intronic
920971397 1:210746334-210746356 CCTCATCTGTAAAATGAAAGGGG - Intronic
920987562 1:210904844-210904866 CCTCATCTGTAAAATGGAGGAGG - Intronic
921075306 1:211695841-211695863 CCTCATCTGTAAAATAGAGATGG - Intergenic
921165494 1:212503926-212503948 GCTCATCTGCATAATAAAGGAGG - Intergenic
921260959 1:213384689-213384711 CCTTGTCTGTAGAATGGAGATGG - Intergenic
921383457 1:214548125-214548147 CTTCATCTGCAAAATGGATCTGG - Intronic
921639111 1:217530321-217530343 CTTCATCTACAAAATGGGGGTGG + Intronic
921749491 1:218776049-218776071 CCTCATCTGCAGAAATGACCTGG - Intergenic
922220813 1:223557304-223557326 CATCTTCGGCTGAATGGAGGTGG - Intronic
922575428 1:226658238-226658260 CCTAGGCTGCAGAGTGGAGGCGG + Intronic
923132137 1:231085287-231085309 CTTCATCTTCAGAATTGAGGAGG - Intergenic
923721907 1:236474034-236474056 CCTCATCTATAAAATGGAGGTGG - Intronic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924371696 1:243357534-243357556 CATCATATACAGAATGGAGGAGG - Intronic
924442194 1:244095818-244095840 CCTCAACTGTAAAATGGGGGTGG - Intergenic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1063620308 10:7641267-7641289 CCTCAACTTCACCATGGAGGAGG + Intronic
1063946397 10:11180399-11180421 CCTCATCTGCAGGATGAACAGGG + Intronic
1063947448 10:11191665-11191687 CCTCATCTTCTGCAGGGAGGAGG - Intronic
1064905578 10:20342336-20342358 GATCATCTGCAGAATGGCTGAGG + Intergenic
1065236838 10:23660593-23660615 CAACACCTGCAGAAGGGAGGTGG - Intergenic
1066626359 10:37410000-37410022 CCTCATTAGCAGACTGGATGTGG + Intergenic
1067319731 10:45206072-45206094 CCGCATCTGGAGTATGGCGGTGG + Intergenic
1067585772 10:47475159-47475181 CCTCATTTGTACAATGGGGGTGG + Intronic
1067764743 10:49076361-49076383 CCTCATCTGCGACATGGAGGAGG - Intronic
1068528770 10:58161777-58161799 CCTCATTTGTAAAATGAAGGGGG - Intergenic
1069610039 10:69766819-69766841 CCTCATCTCCACAAAGGAGGAGG - Intergenic
1069759940 10:70802275-70802297 GCTTAACAGCAGAATGGAGGAGG - Intergenic
1069894802 10:71673720-71673742 CCCCATCTGTAAATTGGAGGTGG + Intronic
1069894933 10:71674639-71674661 CCCCATCTGTAAATTGGAGGTGG - Intronic
1070370986 10:75781798-75781820 TCTCATCTGCAAAATGGGAGTGG - Intronic
1070485461 10:76926349-76926371 CCTCATCTGCAAATTGGAAGAGG + Intronic
1070773824 10:79098446-79098468 CCTCACCTGTAAAATGGAGGTGG + Intronic
1071277153 10:84065729-84065751 CTCCATCTGCAAAATGGTGGTGG - Intergenic
1071495478 10:86164861-86164883 GCACATCAGCAGCATGGAGGAGG + Intronic
1071749464 10:88458238-88458260 CATGTTCTGCAGAATGGATGTGG - Intronic
1072627341 10:97121301-97121323 CCAAGTCTGCAGAAGGGAGGGGG - Intronic
1072772178 10:98151359-98151381 CCTCATTTGTAAAATGGAGGTGG + Intronic
1072991915 10:100204013-100204035 CCTCACATGCAGAAGGGATGAGG + Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073627342 10:105113007-105113029 CCTTATGTGCCAAATGGAGGAGG + Intronic
1073799116 10:107022084-107022106 CCTCATTTCCAGGATGGAGGAGG + Intronic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074309334 10:112308673-112308695 TGTCATCTGCAAAATGGGGGTGG - Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075198513 10:120381970-120381992 AGTCATCTTCAAAATGGAGGAGG - Intergenic
1075596058 10:123730012-123730034 CCTCATCTGCAGAGGAAAGGTGG - Intronic
1075612784 10:123866693-123866715 CTTCAGCTGCAGATTGCAGGCGG - Intronic
1075925441 10:126248128-126248150 CCTCATCTGCAGATTGAGTGTGG + Intronic
1075955075 10:126516619-126516641 CCTCGTCTCCAGCAGGGAGGCGG + Intronic
1076111261 10:127861446-127861468 CCTCATCTGTAAAATGGAGTGGG - Intergenic
1077580361 11:3413555-3413577 CCTCATCTATAAAATGGAGGTGG - Intergenic
1078605608 11:12772413-12772435 CCTCTGATGCAGAATGGAGGAGG + Intronic
1078700346 11:13674446-13674468 CCTCATCTGTAAAATGGAGGGGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079307780 11:19338910-19338932 CCTCATCTGCAGAATGGCTGTGG - Intergenic
1079361029 11:19770473-19770495 CCTTATCTGCTGCATTGAGGTGG + Intronic
1080685084 11:34508749-34508771 CCTCAACTGTAAAATGGTGGAGG - Intronic
1080801169 11:35611643-35611665 ACTCATCTGTAGAATGGAGATGG - Intergenic
1080846153 11:36028895-36028917 CCTCATCTGCAAAATGGAAATGG + Intronic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1081685057 11:45036566-45036588 CTTCATCTGCAGGATGGAGATGG - Intergenic
1082740671 11:56907631-56907653 CCTCATCTGTAAAATGGATGAGG - Intergenic
1083166711 11:60892978-60893000 CCTGAACTGCAGAAGGGAGTAGG - Intronic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1084216412 11:67649050-67649072 CCACACCTGCAAAATGGAGCCGG - Intronic
1084237287 11:67796383-67796405 CCTCATCTATAAAATGGAGGTGG - Intergenic
1084760312 11:71266563-71266585 CCACATTTGCAGAGTGGAGCCGG + Intergenic
1084835116 11:71796445-71796467 CCTCATCTATAAAATAGAGGTGG + Intronic
1084860304 11:72013806-72013828 CCTCATCAGCAGCTTGGAGGAGG - Exonic
1084942182 11:72618702-72618724 TCTCATCTGAAAAATGGAGGTGG - Intronic
1084943465 11:72626465-72626487 CCTGATGTGCAGAATCCAGGAGG + Intronic
1085130255 11:74032168-74032190 CTTCACCTGTAAAATGGAGGCGG - Intronic
1085267220 11:75244011-75244033 CCTCATCTTCAGGATGGGGATGG + Intergenic
1085395444 11:76204930-76204952 CCTTATCTGTAAAATGGTGGCGG + Intronic
1085520750 11:77137746-77137768 CCTCTTCTGCAGGATGGACGTGG + Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085782628 11:79423298-79423320 CTTCATCTGTACAATGGCGGGGG - Intronic
1085798818 11:79568283-79568305 CCTAATCTGAAAAATGGAGATGG + Intergenic
1086157127 11:83679797-83679819 CTTTATCTGTAAAATGGAGGAGG - Intronic
1086380078 11:86243807-86243829 CCTCATCTGTAAAAATGAGGAGG - Intergenic
1086840726 11:91681014-91681036 TCTCATCTACAGAATGGGGGTGG - Intergenic
1088890319 11:114038882-114038904 TCTCATCTGTAAAATGGAGCTGG - Intergenic
1090260536 11:125315670-125315692 GCTCATCTGAAGCATGGAGCGGG - Intronic
1090988614 11:131795925-131795947 CCTGAGCTGCAGCATGGAAGTGG + Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1092295377 12:7193119-7193141 CCTCATCTATAAAATGGGGGTGG - Intronic
1092407954 12:8233976-8233998 CCTCATCTATAAAATGGAGGTGG - Intergenic
1093652170 12:21657982-21658004 CCTCATCTGGAGGGTGGGGGAGG - Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1095852282 12:46823951-46823973 CCTCATCTGCTGCTGGGAGGAGG - Intronic
1096526274 12:52212109-52212131 TCTCATCTGAAGAATAGAGTGGG + Intergenic
1096630878 12:52926054-52926076 CCCCCTCTGCAGAGTGGAAGGGG + Intronic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1099541359 12:83912357-83912379 TTTCATCTGCAGAGTGCAGGTGG + Intergenic
1100441690 12:94623365-94623387 CCTCATCTGCCAAACAGAGGTGG - Intronic
1101013277 12:100473212-100473234 CCTCATCTGTAGAATGGATATGG - Intergenic
1101330766 12:103755922-103755944 CCTCATCTATAAAATGGAGATGG + Intronic
1101398915 12:104371692-104371714 CCTCAGCTGGAAAATGGGGGTGG + Intergenic
1101521941 12:105492075-105492097 TATCATCTGCAAAAAGGAGGTGG - Intergenic
1101722571 12:107362891-107362913 CCTCATCTACAAAATGGAAATGG - Intronic
1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG + Intergenic
1101828488 12:108239400-108239422 CCTAACCTGCAGCCTGGAGGTGG - Intronic
1101876631 12:108600336-108600358 CCTCCTCTGTAAAATGGAGATGG + Intergenic
1101963818 12:109268568-109268590 CCTCATCTGCACAACAGGGGTGG - Intergenic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102187911 12:110964327-110964349 CCACATCTGTAGAATGGAGATGG - Intergenic
1102493328 12:113302350-113302372 CCTCCTCTGGAGCTTGGAGGTGG + Intronic
1102594203 12:113980023-113980045 CCTCAGCAGTAGAATGGAAGAGG - Intergenic
1102785994 12:115605327-115605349 CCTCTTCTGCAAAATGGAATAGG - Intergenic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103913722 12:124365421-124365443 GCTCATCTGCAGGAAGGAGATGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104857856 12:131910237-131910259 ACTCATCTGCAGGAGGAAGGAGG - Exonic
1105618954 13:22048423-22048445 CCTCATCTGCCAAATGGACATGG - Intergenic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1109055560 13:57543755-57543777 TATCATCTGCAGAATGAAGCAGG - Intergenic
1112329605 13:98467060-98467082 TCTCATCTGTAGAATGGAGGTGG + Intronic
1112562673 13:100527858-100527880 CCTCCTCTGTAGAAGCGAGGGGG - Intronic
1112776293 13:102846920-102846942 TCTCATCTGCAAAGTAGAGGTGG + Intronic
1113082271 13:106532808-106532830 CTTCATCATCAGAATGGGGGGGG + Intronic
1113333200 13:109352173-109352195 ACTCATCTGTAAAATGGAGATGG - Intergenic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1116937291 14:50754308-50754330 TATCATCAGCAGAATTGAGGAGG - Intronic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1117610385 14:57477074-57477096 CTTCATCTGTAGAAGAGAGGTGG + Intronic
1118025675 14:61765845-61765867 GCTCATCAGAAGAAAGGAGGAGG - Intronic
1118055887 14:62079432-62079454 CCTCAACTGTAAAATGGAGATGG - Intronic
1118147784 14:63158583-63158605 TCTCATCTGTAAAATGGAAGGGG + Intergenic
1118390181 14:65289045-65289067 CTTCATATTCAGGATGGAGGAGG - Intergenic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118608173 14:67518343-67518365 TCTCATCTGCAAAATGGAAATGG + Intronic
1118763119 14:68892643-68892665 CCTCATCTATACCATGGAGGGGG + Intronic
1119669273 14:76506369-76506391 CCTTCTCTGCAGAATGGTGGGGG + Intergenic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1120841602 14:89090326-89090348 GCTCATCTGTAAAATGGAGTTGG - Intergenic
1120845668 14:89122811-89122833 CCTCCTCTGAAAAATGGGGGAGG - Intergenic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121562671 14:94886592-94886614 CCTCATCTGTGAAATGGAGGTGG + Intergenic
1121587983 14:95076993-95077015 CCTCATCTATAAAATGGAGTTGG - Intergenic
1121989754 14:98544635-98544657 CCTCATCTATAGAAGGGAGCTGG - Intergenic
1122134533 14:99625251-99625273 CCTCCTCTGCAGATGGGAGGAGG - Intergenic
1122570222 14:102693169-102693191 CCTGATCTGCAGAATTAAGGAGG - Intronic
1122831087 14:104396237-104396259 GCTCATCTTCAGAAATGAGGAGG + Intergenic
1123800503 15:23814853-23814875 CCTCATTTGCTAAATGGAGATGG + Intergenic
1124238013 15:28006056-28006078 CCTCAACTATAAAATGGAGGTGG + Intronic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1124841094 15:33242923-33242945 CCTCATTTGTAAAATGGAGAGGG - Intergenic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1127634654 15:60857869-60857891 TCTCATCTGTGAAATGGAGGTGG - Intronic
1127661734 15:61105859-61105881 TCTCACCTGAAGAATGGAAGTGG - Intronic
1127709105 15:61577990-61578012 CCTCATCTGTAAAATGGAGGTGG + Intergenic
1128438104 15:67675868-67675890 ACTCATTTTCAGAATGGAAGAGG - Intronic
1128487327 15:68106737-68106759 CCTGATCTGTAGAGTGAAGGGGG + Intronic
1128732669 15:70031655-70031677 CCTCTTCTGTAAAATGGAGCTGG + Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1128910427 15:71508615-71508637 CCTCATCTGCAAAGTAAAGGGGG + Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129109329 15:73328604-73328626 CCTCATCTGCAGGGCGGGGGTGG - Intronic
1129668991 15:77596661-77596683 CCTCCTCTGCAGAATGGCTTAGG + Intergenic
1130563704 15:84977942-84977964 CCTCAGCTCCAGAATGGATGAGG - Intergenic
1131245578 15:90789359-90789381 CCTCATCTGGAGGCTGCAGGCGG + Intronic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132474315 16:125797-125819 CCTCAGCTACAGAAAGGAGAGGG + Intronic
1132561250 16:595287-595309 CCTCGTCTGCACAGTGGGGGTGG - Intronic
1132792477 16:1699431-1699453 CGTGATCTCCAGAATGGAAGCGG - Exonic
1132833307 16:1940366-1940388 CCTCCTCTGCAGAGTGGCGGTGG - Intronic
1133296171 16:4753540-4753562 CCCCATCTGCAGGATGGAGATGG - Intronic
1133348901 16:5088806-5088828 CCTCATCTATAAAATGGAGGTGG - Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133670447 16:8013747-8013769 CCTCTTCTCCAAAATGTAGGAGG + Intergenic
1133689384 16:8198692-8198714 CCAGATCAGCAGAGTGGAGGTGG - Intergenic
1133862598 16:9610199-9610221 CCTCATCTGTTAAATGGAGATGG + Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134771506 16:16813233-16813255 CTTCATCTGTATAATGGTGGTGG - Intergenic
1134781032 16:16895718-16895740 TCTCATCTGTGGAATGGCGGCGG - Intergenic
1134825405 16:17280378-17280400 CATCTTCTGAAGAATGGAGGTGG + Intronic
1135051794 16:19199278-19199300 CCTCCTGTGTAGAATGAAGGAGG - Intronic
1135160156 16:20087199-20087221 CCTCATCTGTAACATGGAGAAGG - Intergenic
1135394253 16:22119006-22119028 GCTCACCTGCACCATGGAGGAGG + Exonic
1135472835 16:22747035-22747057 CTTCTTCTGCAGAATAGTGGTGG + Intergenic
1136028807 16:27488044-27488066 TCTCATCTGCCAAATGGATGTGG + Intronic
1136061771 16:27731504-27731526 CCCCATCTGTAAAATGGAGCTGG - Intronic
1136065425 16:27755195-27755217 CCTCATCTCCAAAATGAAGCTGG + Intronic
1136346849 16:29681244-29681266 CCACATCTGGACAATGGAGTTGG + Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1137768795 16:50998020-50998042 CCCCAACTGCAAAATGGGGGCGG - Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138131681 16:54485154-54485176 CCTCGTCTGTAGAATGGATATGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1139824348 16:69745336-69745358 CCCCATCTGTAAAATGGAGACGG - Intronic
1140209197 16:72957861-72957883 CAGAACCTGCAGAATGGAGGGGG - Exonic
1140443323 16:75003493-75003515 CCTTACCTGCACAATGGGGGTGG - Intronic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141735557 16:85850050-85850072 CCTCATCTGCAGAACAGAGTCGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1143385852 17:6530073-6530095 CCTCATCTGTAGAATGGCAAGGG - Intronic
1143726491 17:8850442-8850464 CCCCATCTGCAGAACTGGGGAGG - Intronic
1143995643 17:11004120-11004142 CCTCATCTGAAGTGTGGAGAAGG - Intergenic
1144074626 17:11705504-11705526 CCTCATCTGTGAAATGGAAGTGG + Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144522911 17:15966308-15966330 CCTCAGCAGCAGGTTGGAGGCGG + Intronic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144778267 17:17795636-17795658 ACTCATCTGCACCAAGGAGGAGG + Exonic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145218002 17:21066634-21066656 GCTGATCTCCAGAATGGAGATGG + Intergenic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145823345 17:27857542-27857564 CCTCATCAGTAGAATGGGGGTGG - Intronic
1145834358 17:27943035-27943057 CCTCAACTACAAAATGGAGCTGG - Intergenic
1145868166 17:28253829-28253851 CCTCATCTGTGAAATGGAGCTGG + Intergenic
1146255494 17:31389775-31389797 CCTACCCTGCAAAATGGAGGTGG - Intergenic
1146689566 17:34863911-34863933 CCGCATCTGTAGAATAGATGGGG - Intergenic
1146915270 17:36674260-36674282 CTCCATCTTCAGAAGGGAGGAGG - Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147039796 17:37709800-37709822 CCTCATCTATAAAATGGGGGCGG - Intronic
1147043591 17:37736434-37736456 CTTCATCTGTAAAATGGAGGTGG - Intronic
1147121148 17:38335810-38335832 GCTCCTCTGCAGAATGAAGGTGG - Intronic
1147811009 17:43169882-43169904 CCACATCTGCAGTGTAGAGGGGG - Intergenic
1147923940 17:43935375-43935397 CCTCATCTGTGAAATGGAGCTGG - Intergenic
1148588060 17:48794942-48794964 CCTCATCTGTAAGATGGAGATGG + Intronic
1148732654 17:49846915-49846937 CCTCACCTGCAAAACGGAGGAGG - Intronic
1148934585 17:51154691-51154713 CCTCATTTGTAAAATGAAGGGGG + Intronic
1148986659 17:51628434-51628456 CCTCCTCTGCGAAATGGGGGAGG - Intergenic
1149346475 17:55741568-55741590 CCTCATCTGTAAAATGAAAGTGG + Intergenic
1149656320 17:58311208-58311230 CATGATCTGCAGGGTGGAGGGGG + Exonic
1149682240 17:58514577-58514599 CCTCCTCTCCACAATGGAGCGGG + Intronic
1150178284 17:63086459-63086481 CCTCATTAGCAGACTGGACGTGG - Intronic
1151340417 17:73467393-73467415 CCTCATCTGTAACATGGAGATGG + Intronic
1151552008 17:74827757-74827779 CCACATTTGCAGGCTGGAGGTGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152914184 17:83024476-83024498 CCTCACTTGGAGACTGGAGGCGG - Intronic
1153170369 18:2309519-2309541 CTCCATCTGCAAAATGGAGCTGG - Intergenic
1155185209 18:23381741-23381763 CCTCATCTCTAGAATGGAAGAGG + Intronic
1155313074 18:24543979-24544001 CCTCATCTATAAAATGGAGCAGG - Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1156527254 18:37778594-37778616 CCTCAGGTGCAGAAGGGAGGTGG - Intergenic
1156611375 18:38729083-38729105 CCTGACCTGAAGAATGGAGCAGG - Intergenic
1157286266 18:46379449-46379471 CCTCATCTGTAAAATGGACTCGG - Intronic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1157514905 18:48304005-48304027 CTTCATCTGCAAGATGGGGGTGG - Intronic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1158940623 18:62403598-62403620 TCTCATCTCCTGAATGGATGAGG - Intergenic
1160525577 18:79533605-79533627 CCTCATCTGGAGAATTGAAGGGG - Intergenic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1162048096 19:8014783-8014805 CCTCATCTCTAAAATGGGGGTGG + Intronic
1162472199 19:10879104-10879126 CCTCACCTTAAGAATGGTGGAGG - Intronic
1162491496 19:10995235-10995257 CCTTCTCTGGAAAATGGAGGTGG + Intronic
1163060878 19:14760761-14760783 CCTCAACTCCAAAAGGGAGGAGG - Intronic
1163481415 19:17558830-17558852 CCTCATCTGTAACATGGGGGTGG - Intronic
1163748631 19:19062577-19062599 CTTCATCTTCAGGATGGAGAGGG - Intergenic
1163823814 19:19511652-19511674 CCTCATCTGCAAAACTGAAGGGG + Intergenic
1163827002 19:19529426-19529448 CCTCCTCTGGACAAGGGAGGTGG - Exonic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1164587301 19:29484055-29484077 CATCATCTGCAAAATGGGGCTGG - Intergenic
1164809131 19:31142191-31142213 CCTCATCTTTGGAAAGGAGGCGG - Intergenic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166774400 19:45303473-45303495 TCTCATCTGCAGAATGGGAGCGG + Exonic
1166847780 19:45740241-45740263 CCTCCTTTACAAAATGGAGGTGG - Intronic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
1167573507 19:50305577-50305599 CCTCATTTGTATAATGGAGCAGG - Intronic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168332305 19:55577890-55577912 CCCGGTTTGCAGAATGGAGGAGG - Exonic
1168377034 19:55888722-55888744 GCACATCTGCAGAATAGAGAAGG + Intergenic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
925917775 2:8619164-8619186 CCTCAGGTGCAGGATGGAGCTGG - Intergenic
926147120 2:10403404-10403426 TTTCAACTGCAGAATGGAGCTGG - Intronic
926247589 2:11132533-11132555 CCTCATCTGTAGAATGGCGTTGG + Intergenic
926725992 2:15998412-15998434 CCTCAACTGTAAAATGGAGATGG - Intergenic
927318917 2:21720109-21720131 CCCCTTCTGCAGAAGGGAGCTGG - Intergenic
927600062 2:24432899-24432921 CCTCATTTGCAAAATGCTGGGGG - Intergenic
927687006 2:25178048-25178070 CCTCATTTGAACAATGGGGGCGG + Intergenic
928154989 2:28868616-28868638 CCTGATCTGGAGAAAGGAGGAGG + Intronic
928253972 2:29706118-29706140 CCTCATCTGTAAAATGGAGTGGG + Intronic
928399109 2:30965307-30965329 CCTCAGCTGCAGAGGTGAGGAGG - Intronic
928879374 2:36080268-36080290 CCTCATGTTCAAAATGCAGGAGG - Intergenic
929319492 2:40525588-40525610 GCTTAACAGCAGAATGGAGGAGG - Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931284238 2:60819174-60819196 CCTCATCTGCAGAACAGGGCTGG - Intergenic
931989099 2:67771639-67771661 CCTCATCTGTCAAATGGAGATGG - Intergenic
932298372 2:70645356-70645378 CCTCATCTGTAGAATGGAGGAGG + Intronic
932461450 2:71884405-71884427 CTTCATCTGAAAACTGGAGGTGG - Intergenic
932910110 2:75797393-75797415 CCTCATCTGAAAAACGGAGATGG + Intergenic
933820528 2:86107016-86107038 CCTCATCTGCAGACTAGAGTTGG + Intronic
935555661 2:104507215-104507237 CCTCGTCTGTAAAATGGAGATGG - Intergenic
936675352 2:114708228-114708250 CCTCAGCTGCAGTATGAAGTGGG - Intronic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937342201 2:121098482-121098504 CCCCATCTGTAAAATGGAGATGG + Intergenic
937838456 2:126498139-126498161 CCTCAGCAGCAGAATGCAGTTGG + Intergenic
938917972 2:135963260-135963282 CTTCATCTGGAAAATGGAGACGG + Intronic
938946999 2:136222014-136222036 CCTGAGTTGCAGAATGGATGTGG - Intergenic
939404445 2:141737468-141737490 CCTCATCAGGAGACTGGAGGAGG + Intronic
941377752 2:164752247-164752269 CCTCATCTGGAATGTGGAGGTGG - Intronic
941498414 2:166237465-166237487 CTTCATCTCCAGAATGGCAGTGG - Intronic
941747873 2:169106331-169106353 TCTCATCTGTATAATGGGGGTGG + Intergenic
941754793 2:169173562-169173584 CCTCATCTGTAAAATGGAATTGG + Intronic
942202354 2:173583949-173583971 CCTCATCTGTGGAATGGTAGTGG - Intergenic
942844162 2:180402925-180402947 CCTCATCTTCAGAAAGTATGAGG + Intergenic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944617039 2:201471532-201471554 CCTCATCTGCGAAATGGGAGTGG - Intronic
945058389 2:205887878-205887900 CCTGATCTGTGGAATGGGGGTGG - Intergenic
945147351 2:206752525-206752547 CCTCAGCTGCAGGTTGTAGGAGG + Intronic
945195283 2:207231752-207231774 AGTGATTTGCAGAATGGAGGGGG - Intergenic
945608271 2:211964228-211964250 CCTCTTCTGGAGAATGAATGGGG + Intronic
945694474 2:213085685-213085707 CATAATCTGTAGAATGAAGGAGG + Intronic
945818222 2:214631668-214631690 CATCCTATGCAGAATGCAGGGGG - Intergenic
946121849 2:217523214-217523236 TCTCATCTGCAAAATTAAGGTGG - Intronic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948089928 2:235284719-235284741 CCTCATCTGGAAAAAAGAGGAGG - Intergenic
948217828 2:236244941-236244963 CCTCCTCTGTAGAAGAGAGGTGG - Intronic
1168826588 20:818447-818469 CCTCATCTGTAGAATGAGTGAGG + Intergenic
1168830635 20:843610-843632 TCTCATCTGTAAAATGGAGGGGG - Intronic
1168863161 20:1060707-1060729 CCTGATGGGCAGAATGGAGTGGG - Intergenic
1169941170 20:10938875-10938897 TCAGATCTGCAGAATGAAGGGGG - Intergenic
1169943375 20:10962250-10962272 GAACAACTGCAGAATGGAGGAGG + Intergenic
1170415011 20:16130263-16130285 CTTCATCTGCAAAATGAAGGTGG - Intergenic
1170429223 20:16261414-16261436 CATCAGCTGCAGAGTGGTGGGGG - Intergenic
1170542706 20:17405147-17405169 CCTCATCTTCAAAATGTAGGTGG - Intronic
1170907624 20:20530200-20530222 CCTCATCTGTGAAGTGGAGGTGG + Intronic
1172240068 20:33407257-33407279 CCTTTCCTGCAGAAGGGAGGTGG - Intergenic
1172294950 20:33802931-33802953 CCTCAACTGTAAAATGGAGGTGG + Intergenic
1173084834 20:39905804-39905826 CCTCATTTGTAACATGGAGGGGG - Intergenic
1173260775 20:41433001-41433023 ACTCAACAGCAGAATGGTGGAGG + Intronic
1173426131 20:42945239-42945261 CCTCACCTGCAAAATGGAACCGG - Intronic
1173551219 20:43934388-43934410 CCTCACCTGCACGGTGGAGGTGG - Intronic
1174292842 20:49521204-49521226 ACTCATCTGTAAAATGGAGATGG - Intronic
1174307503 20:49624584-49624606 TCTCATTTGGAGAAGGGAGGTGG - Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174802618 20:53576828-53576850 CCTCATCTGTAGAACCAAGGCGG - Exonic
1175324925 20:58117244-58117266 ACTCATCTGTAGACTGGACGAGG + Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1175838847 20:62014187-62014209 CCTCATCTGCAAAGTAGAGATGG - Intronic
1175949935 20:62577971-62577993 TGTCATCTGCAGAATGGATGCGG + Intergenic
1176035223 20:63032966-63032988 CCCCAAGTGCAGAAAGGAGGTGG + Intergenic
1177056420 21:16309559-16309581 GTGCATCTGCAGACTGGAGGGGG - Intergenic
1177647232 21:23914878-23914900 CCTCATTGGTAGAATGGAGATGG - Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1177748462 21:25250866-25250888 CCTAAGCTGGTGAATGGAGGAGG - Intergenic
1178704522 21:34862215-34862237 CCTCATCAGCAAAATGAGGGGGG + Intronic
1179675305 21:42976965-42976987 CCATAGCTGCAGAATGGATGTGG + Intronic
1180015387 21:45079034-45079056 CCACTACTGCAGACTGGAGGAGG + Intronic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1182052093 22:27321140-27321162 CCTCATCTGTAAAATGGAAATGG + Intergenic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182115727 22:27755220-27755242 CCTCATCTGCAACTTGGGGGTGG + Intronic
1182137783 22:27921733-27921755 CATCATCTGGGGAATGGTGGAGG + Intergenic
1182452766 22:30431010-30431032 CTGCATCTCCAGAATGGAGCAGG - Intergenic
1182455750 22:30449239-30449261 CCACATCTGTAAAATTGAGGTGG + Intronic
1182548848 22:31090499-31090521 CCCCATCTGCAGAAAGGATCTGG + Intronic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182882262 22:33743725-33743747 CATCATCTGTAAAATGGGGGTGG - Intronic
1183048943 22:35245233-35245255 GCTCAACGGCAGAATGGAGGTGG - Intergenic
1183093820 22:35540720-35540742 CCTCATCTGGGGACAGGAGGAGG + Intergenic
1183114834 22:35683388-35683410 CCTTATATGCAGATTGGAGAAGG + Intergenic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
1183396556 22:37574779-37574801 CCTCCTCTGCAGAGAGGAGGCGG - Intronic
1183414761 22:37675854-37675876 CCACATCTGTAAAATGGGGGTGG + Intronic
1183678554 22:39313417-39313439 CCTCATCTGCCGGATGGTGGGGG - Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184160567 22:42694943-42694965 CCTCATCTGTAGGGTGGGGGTGG - Exonic
1184568775 22:45309600-45309622 CCTCATTTGCAGAAAGGGGGCGG - Exonic
1184599473 22:45534026-45534048 GCTCATCTGCAGGAGGGAGGTGG + Intronic
1184628957 22:45760698-45760720 CCTCATCTGCAACATGGGAGAGG - Intronic
1184669825 22:46006795-46006817 CCCCATCTGCAGACAGGAGGCGG - Intergenic
1184682480 22:46079708-46079730 CCCCATCTACAGAAAGAAGGGGG - Intronic
1184757889 22:46527102-46527124 GCTCATCTCTAGGATGGAGGTGG + Intronic
1185104251 22:48858271-48858293 CATCATCTGCAGGATGGTGGTGG - Intergenic
1185106887 22:48876287-48876309 GCTCATCTGTAGACTGGACGAGG + Intergenic
949807279 3:7969623-7969645 CCTCCTCTGTAAAATGAAGGTGG - Intergenic
949894200 3:8757160-8757182 CCTTATCTGTAGCATGGAGGCGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950793173 3:15489535-15489557 CCACCTCTGAAGAATGGTGGTGG + Exonic
951698707 3:25472558-25472580 CCTCATCTGTGAAATGGAGGGGG - Intronic
952191804 3:31030508-31030530 CCTCCTCTGTAAAATGGAGCCGG + Intergenic
952943591 3:38460917-38460939 CCTTGGCTGGAGAATGGAGGAGG + Intronic
952956838 3:38562850-38562872 TCCCATCTGTAGAATAGAGGTGG - Intronic
953882972 3:46701149-46701171 GCCCATTTGCAGAAGGGAGGGGG + Intergenic
954619839 3:51989243-51989265 CCTCATCTGTGAAATGGAGATGG - Intergenic
954786093 3:53093583-53093605 CCTCATGTGCAGAATCTGGGTGG - Intronic
955931988 3:64066592-64066614 ACTGAACTGCAGAATGGAGAAGG + Intergenic
956499590 3:69868266-69868288 TCTCAGCTGCAAAATGGGGGTGG - Intronic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956810655 3:72861219-72861241 CCTCATTTACACAATGGTGGTGG - Intronic
958455433 3:94325344-94325366 TCTCACCTGCAAAATGGAGATGG + Intergenic
960100450 3:113736988-113737010 CATCATCTGTAAAATGAAGGGGG - Intronic
960937439 3:122912501-122912523 CCTCACCTGCCGCATGGAGTGGG - Intronic
961301595 3:125925392-125925414 CCTCATCTATAAAATGGAGGTGG + Intergenic
961380723 3:126494961-126494983 CCTCATCTGCAAAGCGGAGACGG - Intronic
961886872 3:130102463-130102485 CCTCATCTATAAAATGGAGGTGG - Intronic
962471088 3:135709971-135709993 CTTCATCTGTAGAATGGGTGTGG - Intergenic
962603086 3:137010139-137010161 AATCAGCTGCAGAAGGGAGGAGG + Exonic
962929593 3:140024093-140024115 CTTCTTCTGCAAAATGGGGGTGG + Intronic
963234921 3:142947183-142947205 CCTCATCTGTAAAATAGAGCGGG - Intergenic
963843276 3:150130012-150130034 CTACATCTGTAGAATGGAGATGG + Intergenic
965638721 3:170811081-170811103 CCTTATCTGTAAAATGGAGGTGG + Intronic
965772600 3:172196577-172196599 TCTCATCTGTAAAATGGAGGTGG + Intronic
965895611 3:173571961-173571983 CCTCATCTGCAATGTGGAAGTGG - Intronic
966754048 3:183351855-183351877 CTTCATCTGCAAAATGGTGGGGG + Intronic
967202472 3:187084610-187084632 CTTCCTCTGCATAGTGGAGGTGG + Intergenic
967260817 3:187640197-187640219 CCTCATCTGTAAAATGGTAGTGG - Intergenic
967300195 3:188005033-188005055 GCTCATCTGAAGGATGGTGGTGG - Intergenic
968263474 3:197343796-197343818 CCTCAACTACAGCATGGAGGTGG - Intergenic
968808910 4:2791486-2791508 CCCCATCTGTGAAATGGAGGGGG - Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
968972126 4:3801496-3801518 CCTCATCTGCTTAAAGGAGGAGG - Intergenic
968996037 4:3946468-3946490 TCTCATCTATAAAATGGAGGTGG - Intergenic
969038296 4:4273829-4273851 TCCCATCTCCAGCATGGAGGAGG - Intronic
969364360 4:6685622-6685644 TCTCATCTGTAAAATGGATGGGG - Intergenic
969610955 4:8227602-8227624 CCACATCTGCAGCACCGAGGCGG + Exonic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
969757949 4:9162231-9162253 CCTCATCTATAAAATGGAGGTGG + Intergenic
969817931 4:9699773-9699795 CCTCATCTATAAAATGGAGGTGG + Intergenic
970108129 4:12608220-12608242 CCTCATCTGTAAAATGGAATAGG - Intergenic
970511292 4:16784347-16784369 CCTCATCTGTAGACTGGGGCTGG + Intronic
970599453 4:17629359-17629381 CCTCATCTGCAGAATCCAGATGG + Exonic
971855358 4:32036103-32036125 CATCATCTGGAGAATAGTGGAGG - Intergenic
972281956 4:37610839-37610861 CCTCATCCTTAGAAAGGAGGAGG + Intronic
974108491 4:57499054-57499076 CGTCATCTGTAAAACGGAGGTGG + Intergenic
975881280 4:78910908-78910930 CCTCATCTTCAGAATCCATGAGG - Exonic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976781901 4:88769461-88769483 CCTCATCTGGAAAATGAAGATGG + Intronic
979538146 4:121848345-121848367 CATCATGGGCAGAATGGAGCAGG - Intronic
980254097 4:130353735-130353757 CCTCATCTGTAAAATGAAAGTGG + Intergenic
981936877 4:150248633-150248655 CCTTATCTGCAAAATGGAATTGG + Intronic
985139572 4:186825337-186825359 TCTCATCTGCAAAATGGGAGTGG + Intergenic
985231928 4:187827805-187827827 CATCATCTGGAGGATGGTGGAGG - Intergenic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
985869885 5:2545801-2545823 TCTCCCCTGCTGAATGGAGGTGG - Intergenic
986234355 5:5893513-5893535 CCTCACCTGGAGAATGGGCGTGG - Intergenic
986569583 5:9151077-9151099 CCTCATCTGAACAATGGATATGG + Intronic
986791933 5:11170059-11170081 CCTCATCTGTAAAATGGACTTGG - Intronic
987081229 5:14427279-14427301 CCCCCTGTGCAGATTGGAGGAGG + Intronic
988125930 5:27037071-27037093 CTTCTTCTGCAGAATGTAGGAGG + Intronic
988143642 5:27275574-27275596 ACACATCTGAAGAATGCAGGAGG - Intergenic
989497617 5:42127085-42127107 CCTCATCTGCAAAGTAGAGGTGG - Intergenic
989989353 5:50742814-50742836 CCTAATCTGCAGTTTGGAGCTGG + Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990588246 5:57233954-57233976 CCACATCTTGAGAATGGGGGTGG - Intronic
991086738 5:62654576-62654598 CCTCCTCTGTAAAATGGAGATGG + Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
992283026 5:75201746-75201768 CCTCAATTCCAGAAGGGAGGAGG - Intronic
992401143 5:76412872-76412894 CCTCATCTGTAAAATGTAAGTGG + Intronic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
997471693 5:134120828-134120850 CCTCCTCTGCACAATGGGAGTGG + Intronic
997779839 5:136645579-136645601 CCTCATGTGTACAATGGAGGTGG - Intergenic
998132623 5:139659097-139659119 GCCCATCTGCAGAATGGAGGTGG + Intronic
998254488 5:140574255-140574277 CCTCATCTGGAAAATGTCGGGGG - Intronic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998864023 5:146476746-146476768 TCTCATCTGAAGAACAGAGGAGG - Intronic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999271671 5:150300270-150300292 TATCATCTGTAGAATGGGGGTGG - Intronic
999364091 5:151010134-151010156 CCTCATCTGTAAAATGGATGTGG + Intergenic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
999945688 5:156592709-156592731 CCTCATCTGCAGCATCAAAGTGG + Intronic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000925652 5:167190741-167190763 TCTCATCTGCAGTGTTGAGGGGG + Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001079448 5:168656380-168656402 ACGCATCTGAAGAATAGAGGAGG - Intergenic
1001086665 5:168704981-168705003 CCTCAGCTGTAAAATGGAGGAGG - Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001492469 5:172165287-172165309 CCTCATCTGCAGAGTTGGGTTGG - Intronic
1001583542 5:172817122-172817144 GCTCATCTGCAAAGTGGGGGCGG + Intergenic
1001773200 5:174311161-174311183 CCTCATCTGTGGAATGGGCGTGG + Intergenic
1002349056 5:178569992-178570014 CCTCCTCTCCAGTATGGAGAGGG - Intronic
1002467568 5:179415267-179415289 CTTCATCTGGAGCATAGAGGGGG - Intergenic
1002827911 6:790479-790501 CCTCATCTGTAAAATGAAGGTGG - Intergenic
1002881387 6:1255470-1255492 TTTCATGTGCAGAATGGTGGTGG - Intergenic
1003333824 6:5152154-5152176 CCTCATCTATAGAATGAAGTTGG - Intronic
1003458864 6:6310659-6310681 TCTCATCTGCAAAATGAAGTTGG + Intronic
1003550721 6:7100109-7100131 CATCAGCTGCAAAATGGGGGTGG + Intergenic
1003958657 6:11189683-11189705 CCTCATTTGCAAAATGAATGGGG - Intronic
1005945640 6:30593410-30593432 TCTCATCTGTAAAATGAAGGTGG + Intronic
1006969139 6:38022589-38022611 CCTCATTTGAAAAATGGAGTGGG - Intronic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007283611 6:40731027-40731049 CCTCACCTGTATAATGGAGATGG - Intergenic
1007416481 6:41694229-41694251 TCTCATCTGCACAATGGACTTGG + Intronic
1007791679 6:44312664-44312686 CCTCATCTGTAAAATAGGGGCGG - Intronic
1007856010 6:44858407-44858429 CTTCATCCGTAAAATGGAGGTGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008930334 6:56932391-56932413 CTTTATCAGCAGAATGGAAGTGG + Intronic
1009399807 6:63241061-63241083 ACTCAGCTGAAGACTGGAGGAGG - Intergenic
1011688183 6:89840881-89840903 CCTTATCAGCAGAATGGTGGAGG - Intronic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1012807591 6:103914631-103914653 CCTCATCTTCAGCAGAGAGGTGG - Intergenic
1013164304 6:107575921-107575943 CATCATCTGCAGAATGGCTGGGG + Intronic
1013183835 6:107740312-107740334 CCTCGTTTGCAGGATGGATGTGG - Intronic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1015178208 6:130334440-130334462 CCTCATCTGTAAAATGAAAGAGG - Intronic
1015621531 6:135137003-135137025 CCCCATCTGCAGAATGGGTTGGG + Intergenic
1016011135 6:139138045-139138067 CATCAACTGCAGAACTGAGGGGG - Intronic
1017816788 6:158022033-158022055 CATGTTCTGCAGAAGGGAGGCGG + Intronic
1019513130 7:1428280-1428302 CCTCATCTGCACACAGGCGGTGG - Intergenic
1019553744 7:1618167-1618189 CCTCGGCTGCAGGGTGGAGGGGG + Intergenic
1019577375 7:1744019-1744041 CCTCATCTGCAAAATGGACGGGG - Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020320309 7:6934877-6934899 CCTCATCTATAAAATGGAGGTGG - Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022040764 7:26579351-26579373 CCTCATCTGTAAAATGGAGCTGG + Intergenic
1022214565 7:28245770-28245792 CCTCATCTGAGAAATGAAGGGGG + Intergenic
1022456695 7:30564245-30564267 CCTCTTCTGCAGAGAGAAGGTGG - Intergenic
1022719600 7:32931030-32931052 CCTCAGCTGCAGAAAGGAACAGG - Intergenic
1023642829 7:42277923-42277945 CCACAGCTGTAGAATGGAGAAGG + Intergenic
1023742152 7:43290507-43290529 CCTAAACTCCAGAAGGGAGGGGG + Intronic
1024177971 7:46860754-46860776 CCTTCACTGCAGAATGGAGATGG - Intergenic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1027227406 7:76252782-76252804 TCTCATCTGCAAAATGGAAAGGG + Intronic
1028710629 7:93903560-93903582 CCTCATCTGCAAAATGGAATAGG + Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030889513 7:114982176-114982198 CCTGATGTGCAGAATGGGGCAGG + Intronic
1030938296 7:115614133-115614155 CCTCATCTCCAGGATTCAGGTGG + Intergenic
1031415787 7:121495171-121495193 CCTCATCTGTAGCAGAGAGGGGG + Intergenic
1031872749 7:127104585-127104607 ACTTATCTGGGGAATGGAGGAGG - Intronic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1035387174 7:158481415-158481437 CCTGGGCTGCAGAATGGACGAGG - Intronic
1035523450 8:293324-293346 CCTCCTCTGCACAATGGTGTTGG - Intergenic
1035582054 8:746595-746617 CCTCATCTGCTGAATGAATGTGG + Intergenic
1035926828 8:3736778-3736800 CCTCATCTGCAAAGTGGGAGTGG + Intronic
1036381202 8:8237553-8237575 CCTCATCTATAAAATGGAGGTGG + Intergenic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1036848361 8:12185075-12185097 CCTCATCTATAAAATGGAGGTGG - Intronic
1036869721 8:12427356-12427378 CCTCATCTATAAAATGGAGGTGG - Intronic
1036959801 8:13231668-13231690 CCTCATCTGTTAAATGGAGGTGG - Intronic
1037510313 8:19575979-19576001 CCTGCTCTGCAGAAAGGAAGGGG - Intronic
1037829818 8:22180797-22180819 CCTCATCTGTAAAATAAAGGTGG - Intronic
1037906385 8:22718272-22718294 CCCCAGCTGCAGAAGGGAGGAGG - Intronic
1037990481 8:23318519-23318541 TTTCATCTGGAGGATGGAGGTGG - Intronic
1038219965 8:25598046-25598068 TCTCATCTGCAAAATGGACCTGG + Intergenic
1038693053 8:29780682-29780704 CCCCATCTGTAAAATGAAGGTGG + Intergenic
1039552802 8:38455394-38455416 CCTCAGCTGGAGACTGGAGCTGG + Intronic
1039862258 8:41468974-41468996 CCTGAGCTGCAGTGTGGAGGGGG - Intergenic
1040425574 8:47281949-47281971 CATAGTCTGCAGAATGGAAGTGG + Intronic
1041045771 8:53884553-53884575 CCTCATCTGTAAAACGAAGGAGG - Intronic
1042892153 8:73624552-73624574 CCTCATCTGTAAAATGAAGTGGG - Intronic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1046668042 8:117026695-117026717 CCTTATCTGCAGAACAGGGGAGG + Intronic
1046999756 8:120562267-120562289 CCTCATCTGAACAAAGGGGGCGG - Intronic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047797263 8:128270463-128270485 CCTCATTTGTAAAATGGAGATGG - Intergenic
1048256871 8:132911593-132911615 TCTCATCTGCCAAATGGAGCTGG + Intronic
1048870523 8:138793452-138793474 CTTCCTCTGTACAATGGAGGAGG - Intronic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1049000737 8:139824253-139824275 CCTCATCTGCAAAACGGATGAGG + Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049309166 8:141924293-141924315 CCTGGTCTGCAGCATGGAGGTGG - Intergenic
1049419139 8:142509300-142509322 CCTCATCTTTAAAATGGGGGTGG - Intronic
1050739392 9:8802748-8802770 CCTCATCTTTAAAATGGAGATGG + Intronic
1051684751 9:19646383-19646405 CCTCCTCAGCAGCATGCAGGGGG + Intronic
1052243583 9:26305901-26305923 TATTATCTTCAGAATGGAGGAGG - Intergenic
1053419129 9:37965831-37965853 CCTCATCTGTACAGTGGGGGCGG + Intronic
1054769794 9:69072809-69072831 CCTCAGCTGCATAATGAAGCTGG - Exonic
1054828796 9:69600352-69600374 CCTCATCTGTAAAATGGGAGTGG + Intronic
1054830661 9:69621061-69621083 CCTGATCTGTAAAATGGAGTTGG + Intronic
1056757933 9:89393913-89393935 ACTCATCTGCAAAATGGAAATGG + Intronic
1056958185 9:91099321-91099343 CCTCCACTGCAGATTGGGGGTGG - Intergenic
1057264255 9:93603618-93603640 CGTCATCTGCAGATTCAAGGGGG + Intronic
1057877602 9:98769756-98769778 CCTCATCTGTAAAACAGAGGTGG + Intronic
1057911035 9:99020913-99020935 CTCCATCTGTAAAATGGAGGTGG + Intronic
1058107576 9:100990299-100990321 CCTCATCCACAAAATAGAGGTGG - Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058674535 9:107389184-107389206 CCTCAACTGTAAAATGGAGATGG + Intergenic
1058799057 9:108527069-108527091 CCTAGTCTGCAGAATTGAGTAGG + Intergenic
1058894479 9:109387615-109387637 CCTCATCACTAGAAAGGAGGTGG - Intronic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1059651475 9:116319679-116319701 TCTCATCTGCAGAATGGACTGGG + Intronic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060270908 9:122140811-122140833 CCTCATCTGTAAAATAGAAGGGG - Intergenic
1060557622 9:124517148-124517170 CCTCAGCAACAGAATTGAGGTGG + Intergenic
1060611337 9:124968225-124968247 CCTCAGCTGCATAATGAAGCTGG + Intronic
1060962910 9:127693790-127693812 CCTCATCTGTAGAATGGGAGAGG - Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1062000262 9:134212313-134212335 ATTCATCTGCTGATTGGAGGCGG + Intergenic
1062255358 9:135618239-135618261 CCACATCTGTAGAGTGGAGACGG - Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1188183499 X:27085661-27085683 GCTAATATCCAGAATGGAGGTGG + Intergenic
1190028779 X:46951765-46951787 ACACAACAGCAGAATGGAGGAGG - Intronic
1190287763 X:48971992-48972014 CGTCATCTGGAAAATGGGGGTGG + Intergenic
1190310671 X:49115016-49115038 CCTCATCTGTGAAATGGATGTGG - Intronic
1190404560 X:50073783-50073805 CCACATCAGCAGAATGGAGTGGG - Intronic
1190489405 X:50966347-50966369 CCTCATTTGTAAAATGGAGATGG + Intergenic
1190850770 X:54239005-54239027 ATTCATCTGCAGACAGGAGGTGG - Exonic
1191014475 X:55793765-55793787 CATCATCTGTATAATGCAGGGGG - Intergenic
1191673137 X:63767759-63767781 CCTCACCTCTAGAATGAAGGAGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192496251 X:71618199-71618221 TCTCGTCTGCAAAATGGGGGGGG - Intronic
1192770646 X:74186045-74186067 CCTCATCTTCAGAATCCATGAGG - Intergenic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1195667381 X:107443405-107443427 CTCCCTCTGCACAATGGAGGTGG + Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1198551487 X:137749778-137749800 CCTCATCTGAAAAATTGAGAAGG + Intergenic
1199365907 X:146982791-146982813 CTACATCTGCACCATGGAGGAGG + Intergenic
1199438541 X:147841991-147842013 CTTCATCTGGGGAATGGGGGAGG - Intergenic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1201305041 Y:12542642-12542664 CCTCATCTGCAGGTTGCGGGTGG + Intergenic
1202373780 Y:24215238-24215260 TCACATCTGCATAATAGAGGTGG - Intergenic
1202497001 Y:25454882-25454904 TCACATCTGCATAATAGAGGTGG + Intergenic