ID: 1124456351

View in Genome Browser
Species Human (GRCh38)
Location 15:29846289-29846311
Sequence GAACTGGGGGGACCCTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124456351_1124456360 9 Left 1124456351 15:29846289-29846311 CCCAGTGAGGGTCCCCCCAGTTC 0: 1
1: 0
2: 1
3: 9
4: 87
Right 1124456360 15:29846321-29846343 ACCATGCTCCTTCCCAGCTCAGG 0: 1
1: 0
2: 10
3: 55
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124456351 Original CRISPR GAACTGGGGGGACCCTCACT GGG (reversed) Intronic
900905810 1:5556525-5556547 GAACTGGTGGTAGCCTCTCTGGG + Intergenic
901744017 1:11360743-11360765 GAACTGAGGGCAACCTCCCTGGG + Intergenic
906057264 1:42927028-42927050 GATCTGGGGCGACTCACACTTGG + Exonic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
909502814 1:76354189-76354211 GAACTGGGTTGGTCCTCACTGGG - Intronic
909970730 1:81984637-81984659 GAACTGTGGGGACTCTCAGTTGG - Exonic
914884455 1:151573883-151573905 GAACTGGAGGTATCCTCCCTGGG + Intronic
917964219 1:180168272-180168294 GCACTGGGAGGGCCCTCGCTGGG + Intronic
922739695 1:228008124-228008146 GAACTGGGGTGATCCTTGCTTGG - Intronic
923139323 1:231147783-231147805 AACCAGGGGGGTCCCTCACTTGG - Intergenic
1069755773 10:70773790-70773812 GAACTGGGGGAGGCCTCACAAGG - Intronic
1071562128 10:86652782-86652804 GAAGTGGGAGCAGCCTCACTGGG - Intergenic
1072535871 10:96362314-96362336 CCATTGGAGGGACCCTCACTGGG - Intergenic
1075007262 10:118839953-118839975 GAACTGGGGGCTACCCCACTGGG - Intergenic
1078421923 11:11219538-11219560 AAACTGGGGGGACGCTCACTGGG - Intergenic
1078893757 11:15580061-15580083 GGACTGGAGGGACCCTCAGCAGG + Intergenic
1081753824 11:45530898-45530920 GAACAGGTGGCACCCTCGCTGGG + Intergenic
1081975627 11:47232818-47232840 GAGCTGGAGGGAGCATCACTGGG + Exonic
1082756716 11:57083791-57083813 GAACTGGGGGAACCTACAATGGG + Intergenic
1084723337 11:70923954-70923976 GCACTGGGGGAGCCATCACTGGG - Intronic
1085298297 11:75443307-75443329 GATCTGGGGGGTCACTGACTCGG - Intronic
1086404706 11:86489691-86489713 GAGCTGGGGAGACTCTCCCTGGG + Intronic
1089271858 11:117307022-117307044 GAACTGGGGGGATTCTGACGTGG - Intronic
1089303182 11:117510965-117510987 GATTTGGGAGGAACCTCACTGGG - Intronic
1089538012 11:119172644-119172666 GAAGTGGGTGGAGCCTCACATGG + Intronic
1090467136 11:126944651-126944673 GAGGTGCGGGGAGCCTCACTTGG - Intronic
1102084857 12:110127878-110127900 GACTTGGGTGTACCCTCACTTGG + Intronic
1102698084 12:114815501-114815523 GCCTTGCGGGGACCCTCACTCGG - Intergenic
1104425069 12:128669588-128669610 GAACCGGTGGGAACTTCACTTGG + Intronic
1108379049 13:49839512-49839534 GCACTGGGAGGGCCTTCACTGGG - Intergenic
1113941956 13:114023112-114023134 GCCCTGGGGGGACCCTTAATGGG - Intronic
1114228902 14:20762792-20762814 CAACTGGGGGCACCCTTACCGGG + Intergenic
1117086537 14:52207376-52207398 GATCTGGAGGCAACCTCACTGGG + Intergenic
1117302489 14:54443121-54443143 GGATTGGCGGGACCCTCACTCGG + Intergenic
1122453828 14:101834251-101834273 GAACTGGTGGGACCTTGACTGGG + Intronic
1122939165 14:104973585-104973607 ACACTTGGGGGACCCTTACTGGG - Intronic
1123906747 15:24929297-24929319 GAAATGGGGTGACACTCACTGGG - Intronic
1124456351 15:29846289-29846311 GAACTGGGGGGACCCTCACTGGG - Intronic
1129772043 15:78208616-78208638 GAAGAGGGGAGGCCCTCACTGGG - Intronic
1138399262 16:56732129-56732151 GAAATGGGGAAAGCCTCACTAGG - Intronic
1140481657 16:75265706-75265728 GGACTGGGGGTCGCCTCACTGGG - Intronic
1142204547 16:88776651-88776673 GAACTGGGGGGCCACACACCAGG + Intronic
1144525322 17:15984474-15984496 GAACTTGTAGGAACCTCACTTGG + Intronic
1144919711 17:18753180-18753202 GAAGTGGGGGGACAGTCTCTTGG + Intronic
1148829913 17:50425002-50425024 GAAGTGTGGGGACCCTCCCTAGG + Intergenic
1152605475 17:81287455-81287477 GAAGTGGGGAGACCCGCGCTGGG - Intronic
1152650506 17:81490381-81490403 CAACTGGGGGGCCCCTGACCAGG - Intergenic
1161715663 19:5874875-5874897 GAACTGGGGGGAGTCTCAGCAGG + Intronic
1162199602 19:9010768-9010790 GAGCTGGGTGGACCCTCCTTGGG + Intergenic
1164069221 19:21750863-21750885 GTACTGGGGGGACACGCAATAGG - Intronic
1165857752 19:38890045-38890067 GAACTGGGGAGTCCCTCCCAAGG - Intronic
928266233 2:29814277-29814299 GAACTGGGAGGATCACCACTGGG - Intronic
933790495 2:85880153-85880175 GAACTGGAGGGACAGTGACTGGG + Intronic
934809800 2:97269032-97269054 GAGTTGGAAGGACCCTCACTGGG - Intergenic
934827897 2:97438953-97438975 GAGTTGGAAGGACCCTCACTGGG + Intergenic
937463618 2:122110449-122110471 GATCTGGGGGGGCCCGGACTGGG + Intergenic
947949979 2:234138837-234138859 GAAATGGCGGGACACTCAGTTGG - Intergenic
949043301 2:241859118-241859140 GAGCTGGGGAGACCCCCACGGGG - Intergenic
1169789372 20:9393188-9393210 GATCTGGGGGGCCTCTCACTTGG + Intronic
1170892771 20:20390266-20390288 GAAGTGGGGTGACCCAAACTTGG - Intronic
1170927030 20:20734124-20734146 AAACTGGGTTGACCTTCACTGGG + Intergenic
1177669709 21:24209100-24209122 GAGCTGTGGGGCCCCTCTCTGGG - Intergenic
1179994444 21:44967489-44967511 GAGTTGGGGGGACCCCCAGTGGG - Intronic
1184093006 22:42302128-42302150 GAGCTGAGGGGCCCCTCACTGGG + Intronic
1184560666 22:45261196-45261218 GAAGTGGGGAGAGCCACACTCGG + Intergenic
951545421 3:23820052-23820074 GGACTTGGGGGACCATCTCTAGG - Intronic
955075168 3:55606869-55606891 GAACTGGGGGCTCCCACTCTAGG + Intronic
962855207 3:139339094-139339116 GAACTGGGTGGTCTGTCACTAGG - Intronic
971173130 4:24254406-24254428 GAACTGGGGAGTGCCTCTCTGGG - Intergenic
978854746 4:113381633-113381655 GAACTGGGCAGCCCCTCACTTGG - Exonic
985621847 5:960114-960136 ACACGGGGGGGACACTCACTGGG - Intergenic
995062437 5:107825569-107825591 GAACTGACGGGAACTTCACTGGG - Intergenic
997585814 5:135042674-135042696 GAACAGGGGTGAGCCTCTCTTGG + Intronic
998866563 5:146510201-146510223 GATCTGGAGGGACCACCACTAGG + Intronic
1000110277 5:158101537-158101559 TAACTGGCGGGACCTACACTTGG + Intergenic
1001932545 5:175683611-175683633 GAACTGGGGTGACCAGCACAGGG - Exonic
1001990541 5:176112581-176112603 GAAATGAGGGGACCCTCCCAGGG - Intronic
1002226332 5:177725559-177725581 GAAATGAGGGGACCCTCCCAGGG + Intronic
1002267516 5:178045654-178045676 GAAATGAGGGGACCCTCCCAGGG - Intronic
1004400199 6:15281571-15281593 GAAGTGGGGGGCCCCCCACGCGG - Intronic
1005588054 6:27296196-27296218 GAGCTCAGGGAACCCTCACTAGG - Intronic
1011551937 6:88538071-88538093 GAACTGGGAACAGCCTCACTGGG + Intergenic
1011614714 6:89186998-89187020 GAACAGTGAGAACCCTCACTAGG + Intronic
1011698480 6:89934121-89934143 GAACAGGAGGGACCCTCCCTAGG + Intronic
1013316094 6:108944523-108944545 GAACTGAAGGCACCCTCCCTTGG - Intronic
1019594101 7:1850474-1850496 GAACTTGGGGTACCCCCACCTGG - Intronic
1029629600 7:101742303-101742325 GAAGTGTGGGGACCCTTCCTGGG - Intergenic
1034548000 7:151801509-151801531 GAGCTGGGGGACCCCTCACAGGG + Intronic
1039883367 8:41640899-41640921 GAAGTGGTGGGTCACTCACTGGG + Intergenic
1042978575 8:74500020-74500042 GAACTGGGGAAACAATCACTGGG - Intergenic
1044104731 8:88189638-88189660 GGACAGGGGACACCCTCACTAGG - Intronic
1044829389 8:96231440-96231462 GATCTGGAGGGACACTCAATGGG + Exonic
1048622893 8:136153916-136153938 GAACTATGGGGACTCCCACTAGG + Intergenic
1049446004 8:142631904-142631926 GAACTGTTTGTACCCTCACTTGG + Intergenic
1051956719 9:22703921-22703943 GAACTGGGAGGAACTCCACTGGG + Intergenic
1056265646 9:84894114-84894136 GCACTGGTGAGACCCACACTTGG + Intronic
1190712077 X:53078526-53078548 GAACTGAAGAGACCCACACTTGG + Exonic
1195006562 X:100691089-100691111 GAAATGGGGGGAACCCCACCTGG + Exonic