ID: 1124465661

View in Genome Browser
Species Human (GRCh38)
Location 15:29936951-29936973
Sequence CCATAGGTATGATGGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124465661 Original CRISPR CCATAGGTATGATGGGAAAT TGG (reversed) Intronic
901946993 1:12712134-12712156 CCTTAGGTATGGAGGGAATTGGG + Intergenic
905917181 1:41693561-41693583 ACATAGGCATGATGGGTAAAAGG - Intronic
914764311 1:150624511-150624533 CCAGAGGTAGGCTGGGAAAGTGG + Intronic
922046746 1:221952434-221952456 CTATTCATATGATGGGAAATGGG + Intergenic
923459267 1:234194572-234194594 CCATAGGTTTGAGGGGGAACAGG - Intronic
1076934258 10:133556834-133556856 CCACAGGCATGAGGGGATATGGG + Intronic
1080938518 11:36887357-36887379 CCATAGCTATAATGAGAACTAGG + Intergenic
1083375313 11:62215588-62215610 CCTTAGGTGTGGAGGGAAATGGG - Intergenic
1087319205 11:96638448-96638470 CTATAGGTAGGATAGGATATGGG - Intergenic
1088338640 11:108737852-108737874 CCAAAGATATAATAGGAAATAGG - Intronic
1088528559 11:110784198-110784220 ACATAGGGATTATGGGAAAATGG + Intergenic
1088765333 11:112970017-112970039 CCACAGATATGAAGGTAAATAGG + Intronic
1090190022 11:124761403-124761425 CCAAAGGGAAGAGGGGAAATTGG - Intronic
1090324163 11:125870481-125870503 CCTTAGGTGTGGAGGGAAATGGG + Intergenic
1090589507 11:128250431-128250453 CCAGAGCTATTTTGGGAAATAGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092034494 12:5319978-5320000 CCACAGATATGAAGGGTAATTGG + Intergenic
1094777634 12:33749572-33749594 TCATAGGAATGTTGGTAAATAGG - Intergenic
1096601634 12:52734004-52734026 TCATAGGCACGATGGGAATTTGG + Intergenic
1098227652 12:68341116-68341138 CCAAAGGAAGGATGGGAATTGGG + Intergenic
1099913313 12:88860581-88860603 CCATAGGTATAAGGGAAAGTGGG - Intergenic
1100013887 12:89985446-89985468 ACATAGGAATGGTGGGAAAGAGG - Intergenic
1102831568 12:116006604-116006626 CCATAGGATTGAGGGGAAAGTGG - Intronic
1104523116 12:129493965-129493987 CCTTAGGTATAATGTCAAATGGG + Intronic
1104744888 12:131204431-131204453 CCAGTGGGATGGTGGGAAATGGG - Intergenic
1104789511 12:131472970-131472992 CCAGTGGAATGGTGGGAAATGGG + Intergenic
1109449730 13:62495272-62495294 CCATCAGTATTATAGGAAATGGG + Intergenic
1111727611 13:92032412-92032434 CCATAGGTTTGGGGGGAAACGGG - Intronic
1114737215 14:25054453-25054475 ACATCGGTATGATGGGATCTGGG + Intergenic
1116450659 14:45060963-45060985 GCATATGTATGGTGAGAAATAGG - Intronic
1120299752 14:82691571-82691593 CCAGAGGTAGGCTGGGAAAGTGG + Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1126233334 15:46353607-46353629 ACATAGGTAGGATTTGAAATAGG - Intergenic
1131815510 15:96217407-96217429 CCAGAGGGTTGATGGAAAATGGG - Intergenic
1134046217 16:11103126-11103148 CCAGAGGTTTGGTGGAAAATGGG + Intronic
1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG + Intergenic
1137246879 16:46712866-46712888 CCATATGGCTGATGGGAAGTGGG - Intronic
1140478323 16:75249968-75249990 CCATCCGTATAATGGGAAAGGGG + Intronic
1147358783 17:39918336-39918358 CCAAAGGTAGGATGGGGAAGTGG - Intronic
1147913223 17:43870439-43870461 TCATAGTTCTGATGGGAATTTGG - Intergenic
1153106749 18:1536802-1536824 TCATAGGTATGAAGGGAATATGG - Intergenic
1155608745 18:27638193-27638215 CCATAGTAATTATGGGAAAGGGG + Intergenic
1156577338 18:38333206-38333228 GCAAAAGTATGATGAGAAATAGG - Intergenic
1158649038 18:59270590-59270612 CTATATTTATGAAGGGAAATGGG + Intronic
1162446155 19:10724101-10724123 CGATAAGTATGATGGAAAAAAGG + Intronic
1163210298 19:15835313-15835335 CTATTCGTATGATGGAAAATGGG + Intergenic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1166702488 19:44890429-44890451 GCAGAGGCATGATGGGTAATGGG + Intergenic
1168329758 19:55560812-55560834 CCAGAGAAATGATGAGAAATGGG - Intergenic
925076348 2:1019456-1019478 CCATAGGTGTGCTGGGAATGTGG + Intronic
928753781 2:34500152-34500174 CCACAGAGAAGATGGGAAATTGG + Intergenic
929072259 2:38044498-38044520 ACATATGCATAATGGGAAATGGG - Intronic
931220043 2:60281018-60281040 GCAAAAGTATGATGGGAAACAGG + Intergenic
935047916 2:99498480-99498502 TCTTAGGTATGGAGGGAAATGGG - Intergenic
936887290 2:117327613-117327635 CCATAGGTATTCTGGTAAACTGG + Intergenic
942118472 2:172752151-172752173 CCATGGGTAGGATGGGAATGAGG - Intronic
943988027 2:194647720-194647742 TCAAAGATATGATGGAAAATTGG - Intergenic
1168994694 20:2124434-2124456 CCAAAGGGAGGATGGGAAAAGGG + Intronic
1170774104 20:19360066-19360088 CCATAGGCATGAATGGAAACTGG + Intronic
1172126091 20:32626198-32626220 CCACAGGCATGCTGGGAAGTGGG - Intergenic
1173676318 20:44838828-44838850 CAAAAGGTAAGATGGGAAATGGG + Intergenic
1178040247 21:28632980-28633002 CCATAGGAATGGGAGGAAATAGG - Intergenic
1178426167 21:32480041-32480063 CCATAGGAATTATTGGAAGTAGG - Intronic
1180196638 21:46200334-46200356 GTATAAGTATGATGAGAAATAGG + Intronic
1182659108 22:31912583-31912605 CCATGGGGATGAGGGGAGATGGG + Intergenic
1183060158 22:35331525-35331547 CCACCGGGATGATGTGAAATGGG + Intronic
1184065092 22:42114050-42114072 CCATAGATGTGGAGGGAAATGGG + Intergenic
1184098191 22:42327965-42327987 CCAGAGCTATGATGGGAAGGAGG - Intronic
1184830216 22:46981231-46981253 ACATAAGTATGATGGGAGAGGGG + Intronic
952373974 3:32749862-32749884 CCATAGGTATGTGGGGGAACAGG - Intronic
955866813 3:63392972-63392994 CCATAGGTATGTACAGAAATGGG - Intronic
956017955 3:64904277-64904299 CCACAGGTATCATGAGAGATGGG + Intergenic
957154837 3:76534406-76534428 CTATTCATATGATGGGAAATGGG - Intronic
957582922 3:82099197-82099219 AGATAGGTTTGATGGAAAATAGG - Intergenic
960221175 3:115110327-115110349 CCATAGGGATGATTCAAAATAGG + Intronic
961582244 3:127892357-127892379 CCTTAGGTACGGAGGGAAATGGG - Intergenic
962470072 3:135699003-135699025 CCATATGTGAGATGGGCAATGGG - Intergenic
963831397 3:150013238-150013260 CCAAAGGCAGGATGAGAAATAGG + Intronic
964195110 3:154054938-154054960 AAATAGGACTGATGGGAAATGGG + Intergenic
965283657 3:166787361-166787383 AAATAGATATGATGGGAATTAGG - Intergenic
965362603 3:167760060-167760082 TCAAAGGTATGATGAGAAACAGG - Intronic
965615826 3:170591464-170591486 CCCTATGTATGATGAGAACTCGG - Intronic
968054409 3:195680558-195680580 ACTTAGGTATGCTGGGAACTGGG - Intergenic
968101482 3:195968600-195968622 ACTTAGGTATGCTGGGAACTGGG + Intergenic
975614996 4:76237269-76237291 CCTGAGGCATGATGGGAAGTGGG - Intronic
977424450 4:96849262-96849284 CCATAAGTATTAGTGGAAATTGG + Intergenic
978313882 4:107414875-107414897 TCTTAGGTATGGAGGGAAATGGG - Intergenic
980291693 4:130853160-130853182 CCAAAGGAAGGATGGGAATTGGG + Intergenic
980420412 4:132552194-132552216 CCAAAGGAAACATGGGAAATAGG + Intergenic
981332643 4:143530552-143530574 GCATATTTATGATGGGAAAAAGG + Intronic
981653434 4:147085087-147085109 CCAGAAGTATGCTTGGAAATCGG - Intergenic
985501476 5:250352-250374 CTGTAGGTATGCTGGGAACTAGG - Intronic
985735406 5:1577278-1577300 ACTTAGGTATGCTGGGAAGTAGG + Intergenic
986228605 5:5840805-5840827 CCATAGGCATGAAGGGATAAGGG + Intergenic
986653547 5:9988721-9988743 CCATATGGATGCTGGAAAATTGG + Intergenic
987460885 5:18208340-18208362 CCATAAGTAAAATGGGTAATGGG + Intergenic
988131883 5:27116983-27117005 ACATATGCATGTTGGGAAATGGG - Intronic
988721819 5:33886753-33886775 CCATAGGTGTGGATGGAAATCGG + Intronic
996417568 5:123226955-123226977 CCATAGTTATCATGGAAAAGGGG - Intergenic
997060600 5:130497333-130497355 GAATAGGTAGGATGGGAAAGTGG + Intergenic
998823389 5:146077045-146077067 CTAAAAGGATGATGGGAAATTGG - Intronic
1000244537 5:159438407-159438429 CCATAGGTCAGATAGGAACTGGG + Intergenic
1000392259 5:160736328-160736350 GCAAAGGTATGATGATAAATGGG + Intronic
1004564650 6:16784736-16784758 CCAAAGGTATGATTAGAAATTGG + Intergenic
1012319914 6:97830289-97830311 CTATAGTTATGATGGGTAAGTGG - Intergenic
1012527010 6:100189984-100190006 CCATAAGTATGATGGAAGATTGG - Intergenic
1014622535 6:123686554-123686576 CTTTAGGTATGATGTGAAGTTGG - Intergenic
1014678499 6:124398471-124398493 TGAAAGGTATGATGGAAAATAGG + Intronic
1017443230 6:154483986-154484008 CCATAGGTTTTATGGGATCTGGG + Intronic
1017859148 6:158379104-158379126 GCATAGGTGTGATGTGAAACTGG + Intronic
1018991597 6:168677990-168678012 CTATTCGTATGATGGAAAATAGG - Intergenic
1019303443 7:321336-321358 CCACAGGTGTGATGGGAACAGGG - Intergenic
1023308112 7:38852849-38852871 CCAGAAGGATGATGGTAAATCGG - Intronic
1027702811 7:81488949-81488971 TCTGAGGTATGTTGGGAAATTGG + Intergenic
1030265484 7:107616419-107616441 ACAGAGATATTATGGGAAATTGG - Intronic
1030314135 7:108097071-108097093 TGAAAGGTATGATGGGAAATTGG + Intronic
1030811864 7:113982349-113982371 AGTAAGGTATGATGGGAAATTGG + Intronic
1033030908 7:137825473-137825495 CAACAGCCATGATGGGAAATAGG + Intronic
1035713348 8:1735305-1735327 CCAGAGGTGAGATGGGAAACTGG + Intergenic
1036212112 8:6850672-6850694 GCATATGTATGGTGGGAAGTGGG - Intergenic
1036502829 8:9329165-9329187 CCATAGGTAGGAAGGGCCATGGG + Intergenic
1036510353 8:9394308-9394330 CACTAGGTAAGAGGGGAAATGGG + Intergenic
1041240227 8:55842786-55842808 CCATGGTTTTGTTGGGAAATTGG - Intergenic
1047607691 8:126491168-126491190 CAATATCTGTGATGGGAAATAGG + Intergenic
1050462460 9:5888076-5888098 CCTCAGGTATTATGGGAAAGGGG + Intronic
1050868220 9:10531384-10531406 ACATAGGGATGATGGGGAAATGG + Intronic
1051347076 9:16161818-16161840 GCATAGCAATGATGAGAAATAGG + Intergenic
1052303055 9:26974939-26974961 CCTTAGGTGTGGAGGGAAATGGG + Intronic
1185497728 X:568229-568251 CCTTATGTGGGATGGGAAATTGG - Intergenic
1185551259 X:984074-984096 CCATAGGTAGTATTGGAAACGGG - Intergenic
1189701964 X:43721098-43721120 CCACAGGTATGTGGGGAGATAGG + Intronic
1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG + Intronic
1193757936 X:85431609-85431631 CCAGAGGTATGGTTGGAAGTAGG + Intergenic
1198820660 X:140644747-140644769 CCATATGTATGATGGGGCAGTGG + Intergenic
1198853782 X:140994844-140994866 ACATAGGTATGATGGAAGTTAGG - Intergenic
1199585796 X:149414606-149414628 CCATAGGCAAGAAGAGAAATGGG - Intergenic