ID: 1124466592

View in Genome Browser
Species Human (GRCh38)
Location 15:29945551-29945573
Sequence AAACCCAATGCCCAGGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 137}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124466580_1124466592 20 Left 1124466580 15:29945508-29945530 CCAAGAATTCCCCCAAAGCCACA 0: 1
1: 0
2: 1
3: 43
4: 316
Right 1124466592 15:29945551-29945573 AAACCCAATGCCCAGGATACTGG 0: 1
1: 0
2: 1
3: 3
4: 137
1124466583_1124466592 11 Left 1124466583 15:29945517-29945539 CCCCCAAAGCCACATGGAGGCCC 0: 1
1: 0
2: 2
3: 29
4: 319
Right 1124466592 15:29945551-29945573 AAACCCAATGCCCAGGATACTGG 0: 1
1: 0
2: 1
3: 3
4: 137
1124466585_1124466592 9 Left 1124466585 15:29945519-29945541 CCCAAAGCCACATGGAGGCCCAT 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1124466592 15:29945551-29945573 AAACCCAATGCCCAGGATACTGG 0: 1
1: 0
2: 1
3: 3
4: 137
1124466590_1124466592 -10 Left 1124466590 15:29945538-29945560 CCATGGCAGCACGAAACCCAATG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1124466592 15:29945551-29945573 AAACCCAATGCCCAGGATACTGG 0: 1
1: 0
2: 1
3: 3
4: 137
1124466579_1124466592 29 Left 1124466579 15:29945499-29945521 CCTCACTTGCCAAGAATTCCCCC 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1124466592 15:29945551-29945573 AAACCCAATGCCCAGGATACTGG 0: 1
1: 0
2: 1
3: 3
4: 137
1124466584_1124466592 10 Left 1124466584 15:29945518-29945540 CCCCAAAGCCACATGGAGGCCCA 0: 1
1: 0
2: 1
3: 22
4: 256
Right 1124466592 15:29945551-29945573 AAACCCAATGCCCAGGATACTGG 0: 1
1: 0
2: 1
3: 3
4: 137
1124466586_1124466592 8 Left 1124466586 15:29945520-29945542 CCAAAGCCACATGGAGGCCCATG 0: 1
1: 0
2: 2
3: 18
4: 196
Right 1124466592 15:29945551-29945573 AAACCCAATGCCCAGGATACTGG 0: 1
1: 0
2: 1
3: 3
4: 137
1124466588_1124466592 2 Left 1124466588 15:29945526-29945548 CCACATGGAGGCCCATGGCAGCA 0: 1
1: 0
2: 0
3: 171
4: 495
Right 1124466592 15:29945551-29945573 AAACCCAATGCCCAGGATACTGG 0: 1
1: 0
2: 1
3: 3
4: 137
1124466589_1124466592 -9 Left 1124466589 15:29945537-29945559 CCCATGGCAGCACGAAACCCAAT 0: 1
1: 0
2: 0
3: 10
4: 61
Right 1124466592 15:29945551-29945573 AAACCCAATGCCCAGGATACTGG 0: 1
1: 0
2: 1
3: 3
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124466592 Original CRISPR AAACCCAATGCCCAGGATAC TGG Intronic
902502937 1:16922567-16922589 AATCCTACTGCCCAAGATACAGG - Intronic
905913592 1:41670332-41670354 AAAGCCAATGCCCTGGAGATAGG - Intronic
906941525 1:50259882-50259904 TAACCCAATGCCCAGAAAAGTGG - Intergenic
907594813 1:55709845-55709867 AACCTCAATGCCCAGAATATAGG - Intergenic
912319686 1:108701180-108701202 AAAGCCAAGACCCAGGATAAAGG - Exonic
917401928 1:174659141-174659163 AAACACAATGCCTAGCACACAGG - Intronic
918463777 1:184801374-184801396 AAAAGCATTGCCCAGGAGACTGG + Intronic
1063795359 10:9508211-9508233 AAAACCAATACCCATGACACAGG + Intergenic
1064715798 10:18175546-18175568 ACACCCACTGCCAGGGATACAGG + Intronic
1065941735 10:30570979-30571001 AAACGAAATGGTCAGGATACAGG - Intergenic
1070682424 10:78457704-78457726 AACCCCAAAGCCCAGGACAATGG - Intergenic
1071335696 10:84598735-84598757 AAACACAATGGCAAGGTTACTGG + Intergenic
1072277418 10:93836752-93836774 AAAGACAATGCCCAGCACACAGG + Intergenic
1073946156 10:108752942-108752964 AAACCCAATTTACAGGAAACTGG - Intergenic
1074453902 10:113580982-113581004 ACACCCAGTGCCCAGCATAGTGG - Intronic
1074820820 10:117177031-117177053 AAACCCTGTACCCAGGATGCAGG + Intergenic
1075741918 10:124701234-124701256 AACCCCAGTGCCCAGGCAACTGG + Intronic
1076055089 10:127366379-127366401 AAACCCAGTGACAAGGAGACTGG - Intronic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1077204455 11:1335896-1335918 AGACCAGATGCCCAGGACACGGG + Intergenic
1080017571 11:27523780-27523802 AAAGCCAATGTCCAGCATATAGG - Intergenic
1081522986 11:43900839-43900861 GAACCCAGTGCCCAGGAGGCAGG + Intronic
1082110281 11:48266548-48266570 AGATCCAGTGGCCAGGATACTGG + Intergenic
1083950560 11:65953427-65953449 AAACCCTACTCCCAGGACACTGG + Intronic
1084977789 11:72812811-72812833 AAAAGCCATGCCCAGGAGACAGG - Intergenic
1091250453 11:134139925-134139947 AAACGAAATGCCTAGGATAATGG + Intronic
1091416182 12:287057-287079 TAATTCACTGCCCAGGATACTGG + Intronic
1092026121 12:5242038-5242060 AAACACAATGTCCAAGATAATGG + Intergenic
1093894853 12:24563551-24563573 CAACCCAATGCCCAAGAACCAGG + Intergenic
1094834752 12:34317085-34317107 AGTCCCAATGCACAGGATGCTGG + Intergenic
1095183808 12:39178211-39178233 AAACCCCATACCCAGGCTCCAGG + Intergenic
1098503574 12:71223163-71223185 AAAGCCAATGCCCAGTTCACAGG - Intronic
1099226321 12:79973726-79973748 AGACCCAATTCCCAGTTTACAGG + Intergenic
1101918029 12:108911351-108911373 AAACCCAAAGCCCTGGATTTTGG + Exonic
1106753346 13:32797011-32797033 ACATCCACTGCCCAGGATCCAGG - Intergenic
1109252613 13:60038077-60038099 AAACCCAAAACTCAGGATAGTGG + Intronic
1112439580 13:99416160-99416182 AAAACAAGTGCCCAGGATGCTGG + Intergenic
1113013398 13:105797003-105797025 AAATACAAGGACCAGGATACAGG + Intergenic
1113423488 13:110188103-110188125 AAACCCAAGTCTCAGGATGCTGG - Intronic
1113476060 13:110582185-110582207 AAACCAAAGCCCCAGGAAACGGG - Intergenic
1115187217 14:30702723-30702745 AAATACCATGCCAAGGATACAGG + Intronic
1115752077 14:36504034-36504056 AGGCCCAAAGCCCAGGATTCTGG - Intronic
1119441559 14:74631852-74631874 TAACACCATGCCCAGGATGCAGG - Intergenic
1119877229 14:78071182-78071204 AAACCCAATGGCCAGGAGCCAGG - Intergenic
1120885343 14:89447629-89447651 ACACCCCATGCCTAGGAGACCGG + Intronic
1121334357 14:93068428-93068450 AAAGCCACTGCCCAGGATATGGG + Intronic
1122661936 14:103301894-103301916 TAACATAATTCCCAGGATACAGG + Intergenic
1124260229 15:28183062-28183084 ATACCCTCTGCCCAGGACACCGG + Intronic
1124466592 15:29945551-29945573 AAACCCAATGCCCAGGATACTGG + Intronic
1124648457 15:31457218-31457240 ACACCCAATGCCCACCAAACAGG + Intergenic
1127760845 15:62137748-62137770 AATCTCAATGCCCAGAATGCAGG + Intergenic
1128126239 15:65195168-65195190 AAACCAAATTCCCAGGAGCCGGG + Exonic
1131195535 15:90352048-90352070 AAACCCAATTCCCCAGCTACCGG - Intergenic
1131681992 15:94733254-94733276 ACACCCACTGGCCAGGACACAGG + Intergenic
1133831876 16:9330743-9330765 AAACCCCATGCCCATGAAGCAGG - Intergenic
1136274427 16:29169996-29170018 GAACCGAATGCCCAGGAAAGAGG - Intergenic
1140150830 16:72363275-72363297 AAACCCAATTCCCAGCATACTGG + Intergenic
1142031312 16:87839877-87839899 AAACCCTGTGCCCAGGAGCCAGG + Intronic
1142078709 16:88135642-88135664 GAACCGAATGCCCAGGAAAGAGG - Intergenic
1142210146 16:88804831-88804853 AAGGCCAGTGCCCAGGATGCTGG + Exonic
1144826061 17:18106343-18106365 ACACCCAAAGCTCAGGACACAGG - Intronic
1150128340 17:62652980-62653002 CAACCCAGTGCCCAGGATCTGGG - Intronic
1152427748 17:80227688-80227710 AGGCCCAATGCCCAGGCTGCTGG - Intronic
1154331153 18:13429955-13429977 AGACCCAGGACCCAGGATACCGG - Intronic
1157487670 18:48100085-48100107 AAACCAAATGTCCAGGAGAGGGG - Intronic
1160085735 18:75776166-75776188 AAACCCACTCCCCAGGCTGCAGG + Intergenic
1163845091 19:19634133-19634155 AAACACAATGCCCAGGTTGTTGG + Exonic
1164772538 19:30821193-30821215 AGACCCAAAGACCAGGAGACAGG - Intergenic
1166121564 19:40690288-40690310 CAAGCCAAAGCCCAGGAGACCGG - Intronic
1166660293 19:44642763-44642785 ATACCCAGTGCCTGGGATACTGG + Intergenic
925650434 2:6083919-6083941 ATACTAAATGCACAGGATACAGG + Intergenic
926687349 2:15708521-15708543 GAACCCAAACCCCAGGAGACTGG - Intronic
927292699 2:21420308-21420330 AAACACAAAGCCCAGGAGAATGG + Intergenic
930295856 2:49552774-49552796 TAACCCATTGGCCAGGACACAGG - Intergenic
937763466 2:125632538-125632560 AAAGACAAGGCCCAGGATAAGGG - Intergenic
939084956 2:137708081-137708103 AAGCCCAGTGCCCAGGCTTCAGG + Intergenic
940211596 2:151261400-151261422 ACACCCACTGCCCAGGCGACGGG - Intronic
941720774 2:168810332-168810354 CAAACCAACGCCTAGGATACAGG - Intronic
941926637 2:170902145-170902167 AAACCCCATGTTCAAGATACTGG - Intergenic
943679639 2:190754938-190754960 AAACCCAGTTCTCAGGCTACTGG + Intergenic
1170508139 20:17050018-17050040 ATACCAAATGCCAAGGCTACTGG + Intergenic
1178529844 21:33366744-33366766 AAGGACAATGCCCAGGAGACAGG - Intergenic
1181044213 22:20206988-20207010 AAGCCCAGGGCCCAGCATACAGG - Intergenic
1182497274 22:30718487-30718509 AAGCCCAGTGCCAAGCATACAGG - Intronic
1183049723 22:35250980-35251002 AAGGCCACTGCCCAGGCTACAGG - Intergenic
961383033 3:126508319-126508341 AAACCCACAGCTCAGGATGCAGG - Intronic
964031562 3:152144876-152144898 TAACCCTATGGCCAGGATATTGG + Intergenic
964778679 3:160310795-160310817 AAACCCAATGACCAGTCTAGAGG + Intronic
964942836 3:162181831-162181853 AAACCCAATTCCCATGAGAAGGG - Intergenic
965091223 3:164164757-164164779 ACACCCAAAGCCCAGGAAATAGG + Intergenic
965952619 3:174329332-174329354 GAACCCAAAGCGCAGGATAAAGG + Intergenic
966753900 3:183350357-183350379 AAACCAAATGCACAGGAAATGGG + Intronic
966890516 3:184404450-184404472 AGACTCAGTGCCCAGGATCCAGG + Intronic
969427783 4:7135872-7135894 AAACCCAGTGACCAGGTCACTGG - Intergenic
971321875 4:25612257-25612279 AAACACAATTCCCAGGCTCCAGG - Intergenic
972790112 4:42363750-42363772 AAACCCAATCCCCAGTGTAACGG + Intergenic
976745839 4:88402260-88402282 AAAACCACTGCCCTAGATACAGG - Intronic
976778358 4:88731186-88731208 AAACCCAAGGACCAGGTTACAGG + Intronic
977863342 4:101993703-101993725 AAACGCCCTGCCCAGGATTCTGG - Intronic
981511342 4:145561958-145561980 AAATCCTAGGCCCAGGACACTGG - Intergenic
982655564 4:158144923-158144945 AATCCCAATGTCCAGGACCCTGG + Intronic
986273685 5:6255612-6255634 AAACCCAATTTCCAAGTTACTGG - Intergenic
986732415 5:10645172-10645194 ACCCACAATGCCCAAGATACAGG + Intronic
986984232 5:13481907-13481929 AAACCCAATGCCCTGGACCATGG - Intergenic
988898325 5:35702337-35702359 AAAGCCAATGGGCAGGAGACTGG + Intronic
989950271 5:50289130-50289152 ATACCCAAGGCCCACGATTCAGG + Intergenic
995992147 5:118253580-118253602 AAACCAAAGGCTCAGGATAATGG - Intergenic
997592163 5:135081215-135081237 AAAACTAATTCCCAGGATAATGG - Intronic
1002614206 5:180440438-180440460 AAAGCGAATGCGCAGGATTCAGG - Intergenic
1007350969 6:41273189-41273211 AATGCCACTGCCCTGGATACTGG - Intronic
1011718386 6:90130288-90130310 TAGGCCCATGCCCAGGATACAGG + Intronic
1012856657 6:104509765-104509787 AAAGTCAATGCCCAGGAGAAAGG + Intergenic
1012913205 6:105139751-105139773 AAACACATAGCCCAGGATATGGG + Intergenic
1016988944 6:149916319-149916341 CCACCCAATGCCAAGGACACAGG - Intergenic
1017553820 6:155541636-155541658 AGACCCAAAGCCCAGCAGACAGG - Intergenic
1018732442 6:166662466-166662488 AAATCCAATGCCTATGTTACAGG + Intronic
1019292594 7:257878-257900 GGACCCACTGCCCAGGATGCTGG + Intronic
1022220502 7:28309284-28309306 AAGCCAAATGCCAGGGATACAGG - Intronic
1026290637 7:69002790-69002812 AACCCCAATGAACAGGATTCAGG + Intergenic
1029635783 7:101782862-101782884 AAACCCCAAGTCCAGGATGCTGG - Intergenic
1031095407 7:117413098-117413120 AAACCCAAATCCAAAGATACAGG + Intronic
1033022031 7:137735190-137735212 AAATGCAATGCCAAGGAGACTGG - Intronic
1033649118 7:143327346-143327368 AAATCCCATGCCCACGAGACAGG - Intronic
1034752458 7:153583639-153583661 AAATCCAATCCCCAGTATAATGG + Intergenic
1035932759 8:3801900-3801922 ATACCCAATGCCTAGGGTATAGG + Intronic
1037695186 8:21217356-21217378 AAAGGCAATGAACAGGATACAGG + Intergenic
1038503107 8:28061916-28061938 AAACCCACTGCCCTGGATCAGGG - Intronic
1041799817 8:61786930-61786952 ACACACAATGCCCAGGACCCTGG - Intergenic
1043762845 8:84090806-84090828 AAACCCAAACACCATGATACTGG - Intergenic
1043939155 8:86177079-86177101 ATAGCCAATGCAAAGGATACGGG + Intergenic
1049026414 8:139993285-139993307 AAACCCAATGACCAATAAACAGG + Intronic
1052265486 9:26566910-26566932 AATCACAATGACCAGGATATAGG + Intergenic
1053422051 9:37985881-37985903 ACTCCCAGTGCCCAGGACACAGG - Intronic
1053786880 9:41658549-41658571 AAAGCCAATGTCCAGGGGACGGG - Intergenic
1058432362 9:104930125-104930147 AAGCCCAAGGCCCAGGAGAGCGG + Intergenic
1061306109 9:129734295-129734317 AGACCCAAGGCCCAGGGAACAGG - Intergenic
1061404007 9:130383671-130383693 GGACCCAGAGCCCAGGATACTGG - Intronic
1186516528 X:10170468-10170490 AAACACAATGGCAAGGATGCAGG + Intronic
1190873818 X:54445963-54445985 AAACCCAAGACCCAGCATTCGGG + Exonic
1193809086 X:86030417-86030439 AAACAGAATTTCCAGGATACAGG + Intronic
1196128102 X:112121073-112121095 AAAACAAATGCCCATGACACAGG + Intergenic
1200164192 X:154024968-154024990 AAAACAAAAGCCCAGGATAGAGG + Intronic