ID: 1124466991

View in Genome Browser
Species Human (GRCh38)
Location 15:29949031-29949053
Sequence GTGGCGGAGGTGATGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1176
Summary {0: 1, 1: 0, 2: 21, 3: 220, 4: 934}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124466991 Original CRISPR GTGGCGGAGGTGATGGTGGT GGG (reversed) Intronic
900415519 1:2532750-2532772 CTGCCGGAGGTGAGGGTGGTGGG + Intergenic
900500699 1:3003141-3003163 GTGGCAGAGGACATGGAGGTGGG + Intergenic
900505269 1:3027256-3027278 GTGGAGGAGATGATGGAGGCAGG - Intergenic
900906286 1:5561867-5561889 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
900906287 1:5561870-5561892 GTGGTGGTGGTGGTGGTGGGAGG + Intergenic
901004875 1:6166768-6166790 GTGGGAGAGATGGTGGTGGTGGG - Intronic
901194088 1:7430572-7430594 ATGGTGGAGGTGATGGTGACAGG + Intronic
901214547 1:7548499-7548521 GGGGTGGAGGTGCTGGTGGAGGG + Intronic
901214594 1:7548630-7548652 GGGGTGGAGGTGCTGGTGGAGGG + Intronic
901214649 1:7548792-7548814 GGGGCGGAGGTGCTGGTGGAGGG + Intronic
901214675 1:7548857-7548879 GGGGTGGAGGTGCTGGTGGAGGG + Intronic
901214774 1:7549150-7549172 GGGGCGGAGGTGCTGGTGGAGGG + Intronic
901383832 1:8893485-8893507 GTGGTGGCGGTGACGGTGGCGGG - Intergenic
901465010 1:9415942-9415964 GTGGTGGTGGTGGTAGTGGTGGG + Intergenic
902095565 1:13941750-13941772 GTGGTGGTGGTGATGGTGGTAGG - Intergenic
902389450 1:16094633-16094655 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
902488388 1:16763137-16763159 GTGGCGGTGGTGGTGGTGGTGGG + Intronic
902741919 1:18444874-18444896 CTGGGGCAGGTGGTGGTGGTAGG - Intergenic
903049609 1:20590842-20590864 GTGGGGCAGGTGGTGGTGATGGG + Intronic
903217477 1:21851474-21851496 GTGGCGGAGGTTATTGGGGGAGG - Intronic
904034309 1:27550807-27550829 GTGGAGGAGGCGGTGGTGGTGGG + Exonic
904050788 1:27637030-27637052 ATGGCGGAGGTGATGCTGCCCGG - Intergenic
904079817 1:27864957-27864979 GAGGCGGAGGTGGTGGTGAGCGG + Intergenic
904272873 1:29362018-29362040 GTGGTGGTGGTGGTGGTTGTTGG + Intergenic
904614260 1:31741581-31741603 ATGGCAGGGGTGGTGGTGGTGGG + Intronic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
904842135 1:33379436-33379458 GGGGCGGGGGGGATGGTGGGGGG - Intronic
905006205 1:34712384-34712406 GGGCAGGAGGTGATGGTGGGGGG - Intergenic
905227387 1:36488125-36488147 ATGACGGTGGTGGTGGTGGTGGG + Intergenic
905473766 1:38211674-38211696 GTGGGGGAGGTGATGGGGGATGG - Intergenic
905479954 1:38254796-38254818 ATGGCGGTGGTGGTGGTAGTGGG + Intergenic
905988335 1:42309264-42309286 GTGGAGGAGGTCAGTGTGGTTGG - Intronic
906522181 1:46474166-46474188 ATGGAGGAGGTGAAGGTGATGGG + Intergenic
906748146 1:48235854-48235876 GAGCAGGAGCTGATGGTGGTGGG + Exonic
906810716 1:48824469-48824491 GTGGTAGAGGAGATAGTGGTTGG + Intronic
906943420 1:50275637-50275659 AGGGCGGAGGTGGTGGTGGTGGG - Intergenic
907637908 1:56155283-56155305 GTGGTGGAGGTGATGGTGTTGGG + Intergenic
907770051 1:57452587-57452609 GTGGTGCTGGTGATGGTGGTGGG + Intronic
908687224 1:66735119-66735141 GAGGCTGAGGTAGTGGTGGTGGG - Intronic
908840761 1:68278009-68278031 GTGGTGGTGGTGGTGGTGGAGGG - Intergenic
909409268 1:75330307-75330329 GTGGCAGTGGTGGTGGTGGAAGG - Intronic
909449658 1:75784486-75784508 GTGGTGGCGGTGGTGGTGGTGGG + Intronic
910288720 1:85580365-85580387 GTGATGGTGGTGATGGTAGTTGG - Intergenic
910325944 1:86007237-86007259 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
910401696 1:86843720-86843742 GTGGCAGGGGTGGTGGGGGTGGG + Intergenic
910458789 1:87426165-87426187 GTGGTGGTGGTGATGGGGCTTGG - Intergenic
910758886 1:90716929-90716951 GTGGAGGTGGTGATGATGCTGGG + Exonic
911055191 1:93702548-93702570 GTGGGGGTGGGGATGGGGGTTGG + Intronic
911631358 1:100186857-100186879 GTGGTGGTGGTGTTGATGGTGGG - Intergenic
911750676 1:101493699-101493721 TTGGTGGTGGTGGTGGTGGTTGG - Intergenic
912260769 1:108109937-108109959 GTGGTGGTGGTGCTGGTGGTGGG - Intergenic
912533098 1:110340347-110340369 GTGGCGGAGGTGGAGGGGGCAGG - Exonic
912692597 1:111815624-111815646 GGGTCAGAGGTGTTGGTGGTTGG - Intronic
913146393 1:115994177-115994199 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
913439164 1:118879005-118879027 GGGGTGGAGGTGCTGGGGGTGGG + Intergenic
913444939 1:118941134-118941156 ATGTCGGAGGTGGTGGTGGGAGG - Intronic
914316070 1:146513055-146513077 GTGGTGGTGGTGATGGGGCTTGG - Intergenic
914355222 1:146879044-146879066 GAGGGAGAGATGATGGTGGTTGG - Intergenic
914442852 1:147722310-147722332 GTGGAGAAGGTGATGGGGGTGGG + Intergenic
914498285 1:148220306-148220328 GTGGTGGTGGTGATGGGGCTTGG + Intergenic
914865889 1:151428296-151428318 GTGGTGAAGGTGTTGGTGGTGGG + Exonic
915068298 1:153244447-153244469 GTGGTGGTGGTGGAGGTGGTGGG + Intergenic
915068342 1:153244645-153244667 GTGGAGGTGGTGGTGATGGTGGG + Intergenic
915075571 1:153306052-153306074 ATGGTGGAGGTGCTGGTGGCAGG + Intronic
915085687 1:153387109-153387131 GTGGTGGCAGTGGTGGTGGTGGG - Intergenic
915121917 1:153634523-153634545 GTGGCGGGATTGATGGAGGTTGG + Intronic
915141676 1:153772034-153772056 GTGGTGGTGGTGGTGGTGATGGG + Intronic
915165365 1:153945338-153945360 GTGGTGGCGGTGGCGGTGGTGGG + Intronic
915313277 1:155015218-155015240 GTGGCGGTGGCGGAGGTGGTGGG - Exonic
915511840 1:156390882-156390904 GTGTGGGAGGCGATGGGGGTTGG + Intergenic
915609284 1:156978248-156978270 GTGGAGGAGGTGGTGGTGAGGGG + Exonic
916108377 1:161446907-161446929 GTGGCGGTGGTGGTGGTGGCGGG + Intergenic
916109964 1:161454287-161454309 GTGGCGGTGGTGGTGGTGGCGGG + Intergenic
916111550 1:161461698-161461720 GTGGCGGTGGTGGTGGTGGCGGG + Intergenic
916113136 1:161469078-161469100 GTGGCGGTGGTGGTGGTGGCGGG + Intergenic
916432531 1:164744875-164744897 GTGGTGGGGGTGGTGGTGGGTGG + Intronic
916562607 1:165946129-165946151 CTGGTGGTGGTGGTGGTGGTGGG + Intergenic
916575062 1:166059776-166059798 GTGGCTGAGGTGGAGGTGTTTGG + Intronic
916769997 1:167898705-167898727 GTGGTGGTGGTGAGGGTTGTAGG + Intronic
918228363 1:182508257-182508279 TTGGTGGTGGTGATGGTTGTTGG + Intronic
918278426 1:182978338-182978360 GTGGGTGTGGTGATGCTGGTGGG - Intergenic
918528931 1:185496080-185496102 CTGGCTGAGATGAAGGTGGTGGG + Intergenic
918811638 1:189129256-189129278 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
918951544 1:191146347-191146369 GTTGTGGAGGTGATTTTGGTGGG - Intergenic
919406684 1:197193693-197193715 GCGGGGGAGGTGGTGGTGGTAGG - Intronic
919468249 1:197948236-197948258 GAGGCTGAGTTGAGGGTGGTAGG + Intergenic
919495910 1:198267791-198267813 CAGGCAGAGGTGAGGGTGGTAGG - Intronic
919678300 1:200409265-200409287 GTGGTGGTGATGGTGGTGGTGGG + Exonic
919898504 1:202025507-202025529 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
919899237 1:202031819-202031841 GTGGCGGTGGGGGTGGTGGGGGG - Intergenic
919972047 1:202587342-202587364 GGGGCGGTGGTGGTGGTGGTTGG - Exonic
920098174 1:203500025-203500047 GTGGTGGTGGTGGCGGTGGTAGG - Intronic
920098211 1:203500142-203500164 GTGGTGGAGGTGGAGGTGGGTGG - Intronic
920098219 1:203500164-203500186 GTGGTGGTGGTGGTGGAGGTGGG - Intronic
920098253 1:203500267-203500289 GTGGTGGAGGTGGAGGTGGGTGG - Intronic
920098279 1:203500346-203500368 GTGGCAGAGGTGGAGGTGGGTGG - Intronic
920214161 1:204350466-204350488 CCTGCGGAGGGGATGGTGGTGGG - Intronic
920302445 1:204997289-204997311 GTGGTGGTGGCGATGGTGGTAGG - Exonic
920302463 1:204997367-204997389 GTCCCGGAGGTGGTGGTGGGAGG - Exonic
920926404 1:210345474-210345496 ATGGCAGTTGTGATGGTGGTCGG - Intronic
921168288 1:212523262-212523284 GTGGTGAGGGTGCTGGTGGTGGG + Intergenic
921219420 1:212962572-212962594 GTGGGGGAGGTGCTAGTGTTCGG - Intronic
922130362 1:222771426-222771448 GTGGTGGTGGGCATGGTGGTGGG + Intergenic
922272147 1:224043837-224043859 GTGGGGGAGGGGATGCTGGTGGG - Intergenic
922615680 1:226960084-226960106 GTGGTGGTGGTGATGGTACTTGG + Intronic
922615710 1:226960212-226960234 GTGGTGGTGGTGATGGTACTTGG + Intronic
922615743 1:226960342-226960364 GTGGTGGTGGTGGTGGTGCTTGG + Intronic
922850755 1:228731764-228731786 CTGGAGGAGGTGTTGGGGGTAGG + Intergenic
923016246 1:230128616-230128638 GTGGCGGGGGCGGGGGTGGTTGG + Intronic
923119556 1:230978243-230978265 GTGGCGGAGGAGATGGCAGGTGG - Intronic
923203201 1:231732807-231732829 GTGACAGTGGTGATAGTGGTTGG + Intronic
923532054 1:234819379-234819401 ATGGTGGCGGTGGTGGTGGTGGG - Intergenic
923782331 1:237036120-237036142 GAGGCAGAGGTGGAGGTGGTAGG - Intergenic
924134297 1:240947608-240947630 GTGGTGGAGGTGGTGGATGTGGG - Intronic
924374587 1:243391823-243391845 GTGCAGGAGGTGGGGGTGGTAGG + Intronic
924381900 1:243473335-243473357 GAGGGGGATGTGATGGTGGCGGG - Intronic
1063142406 10:3267252-3267274 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
1063353959 10:5380990-5381012 GTGGCGGGAGGGATGGTGGATGG - Intergenic
1063676108 10:8141685-8141707 GTGGGGGTGGGGATGGGGGTGGG - Intergenic
1064865026 10:19869804-19869826 GTGGCGGGGGAGTGGGTGGTGGG - Intronic
1064932632 10:20643764-20643786 GTGGCGAAGGTAGTGGTGGCTGG - Intergenic
1066467567 10:35667183-35667205 GTGATGGTGGTGATGATGGTGGG - Intergenic
1066467649 10:35667566-35667588 GTGATGGTGGTGATGATGGTGGG - Intergenic
1066467659 10:35667612-35667634 ATGGTGGTGGTGATGGTGGGGGG - Intergenic
1067784194 10:49230691-49230713 CTGGTGGAGGTGATGGTAATGGG - Intergenic
1067825595 10:49570408-49570430 GTGGGGTAGGTGCTGGTGGTAGG - Intergenic
1068632037 10:59308353-59308375 GTGGTGGTAGTGGTGGTGGTGGG - Intronic
1068632080 10:59308540-59308562 GTGGTGCTGGTGGTGGTGGTGGG - Intronic
1068632087 10:59308562-59308584 CTGGTGGTGGTGATGGTGGTTGG - Intronic
1068632094 10:59308590-59308612 GTGGTGATGGTGATGCTGGTTGG - Intronic
1068866477 10:61900655-61900677 GCGGGGGAGGGGATGGGGGTGGG + Intergenic
1069574722 10:69518348-69518370 GTGGCGGGGGTGTTGGTAGAGGG - Intergenic
1069604604 10:69731544-69731566 GTGGTGGTAGTGATGGTGGAGGG + Intergenic
1069613620 10:69792158-69792180 GTGGTGGTGGTGACGGTGGGTGG - Intergenic
1070789719 10:79181855-79181877 GTGGCTGTGGTGGTGGTGGCTGG - Intronic
1071064552 10:81614912-81614934 GTTTCGGTGGTAATGGTGGTGGG - Intergenic
1072060773 10:91808578-91808600 ATGCTGGAGGTGATAGTGGTTGG + Intronic
1072312582 10:94170952-94170974 GTGGCGGTGGTGGTGGTGGTAGG - Intronic
1072530801 10:96316883-96316905 GTGGTGGCGGTGATGGTAGTAGG - Intronic
1072555991 10:96513925-96513947 GTGGCGGTGGCGGCGGTGGTTGG + Intergenic
1072827813 10:98626192-98626214 GTGGCGGTAGTCATGGAGGTGGG + Intronic
1072914463 10:99529089-99529111 ATGGTGGCGGTGGTGGTGGTGGG - Intergenic
1073047784 10:100651006-100651028 GTGGGAGTGGTGAAGGTGGTGGG - Intergenic
1073047838 10:100651168-100651190 GTGGGAGTGGTGAAGGTGGTGGG - Intergenic
1073047876 10:100651294-100651316 GTGGGGGTGGTGGAGGTGGTGGG - Intergenic
1073047943 10:100651486-100651508 GTGGTGGAGGTGGTGGGAGTGGG - Intergenic
1073047991 10:100651636-100651658 GTGGGGGTGGTGGAGGTGGTGGG - Intergenic
1073048012 10:100651693-100651715 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1073048029 10:100651738-100651760 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1073048046 10:100651783-100651805 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1073048063 10:100651828-100651850 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1073048080 10:100651873-100651895 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1073048097 10:100651918-100651940 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1073048114 10:100651963-100651985 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1073096605 10:100983906-100983928 GTGGGGGCGGTGGGGGTGGTGGG - Exonic
1073099662 10:100999944-100999966 GCGGCGGAGGTGAGGGGGGCCGG + Exonic
1073349942 10:102812641-102812663 GTGGGGGAGGAGTTGGAGGTCGG - Exonic
1074099925 10:110346815-110346837 GTTTGGGAGGTGATGGAGGTGGG - Intergenic
1074379178 10:112964793-112964815 ATGGTGGTGGTGGTGGTGGTGGG + Intronic
1074379181 10:112964796-112964818 GTGGTGGTGGTGGTGGTGGGGGG + Intronic
1074676439 10:115856595-115856617 GTGGCAGGGGTGATGGTTTTGGG + Intronic
1074714018 10:116201812-116201834 GTGGCAGAGGTGAGGGGGGTGGG - Intronic
1074995353 10:118753505-118753527 GTGGCGGTGGTGGTGGTGATAGG - Intronic
1075016044 10:118910573-118910595 GTGGGGGGGGGGATGGGGGTGGG + Intergenic
1075799687 10:125145674-125145696 GTGGTGGTGGTGATAGTAGTAGG - Intronic
1076005777 10:126947439-126947461 TTGGTGGTGGTGGTGGTGGTTGG + Intronic
1076005802 10:126947572-126947594 TTGGTGGTGGTGGTGGTGGTTGG + Intronic
1076005814 10:126947637-126947659 TTGGTGGTGGTGGTGGTGGTTGG + Intronic
1076005819 10:126947668-126947690 CTGTTGGTGGTGATGGTGGTTGG + Intronic
1076005844 10:126947804-126947826 TTGGTGGTGGTGGTGGTGGTTGG + Intronic
1076005867 10:126947937-126947959 TTGGTGGTGGTGGTGGTGGTTGG + Intronic
1076005874 10:126947971-126947993 TTGGTGGTGGTGGTGGTGGTTGG + Intronic
1076005881 10:126948005-126948027 TTGGTGGTGGTGGTGGTGGTTGG + Intronic
1076005910 10:126948172-126948194 CTGTTGGTGGTGATGGTGGTTGG + Intronic
1076137361 10:128054484-128054506 GCGGCGTAGGTGCTGGTGGCTGG + Intronic
1076205678 10:128599548-128599570 GTGGAGGCGGTGGTGGGGGTTGG - Intergenic
1076655646 10:132021815-132021837 GTGGAAGAGGTGTTGGTGGAGGG + Intergenic
1076738434 10:132468821-132468843 GTGGTGGGGGTGTTGGGGGTTGG + Intergenic
1076811501 10:132888728-132888750 GTGGCAGGGGTGAAGGTGGCAGG - Intronic
1076948515 10:133666805-133666827 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076949502 10:133670115-133670137 GTGGTGGCGGTGGTGGTGGTGGG - Intronic
1076949522 10:133670159-133670181 GTGGTGGTGGTGGTGGTGGGGGG - Intronic
1076949525 10:133670162-133670184 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
1076950486 10:133673414-133673436 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076950506 10:133673458-133673480 GTGGTGGTGGTGGTGGTGGGGGG - Intergenic
1076950509 10:133673461-133673483 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1076951473 10:133676713-133676735 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076952463 10:133680023-133680045 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076953449 10:133683333-133683355 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076953469 10:133683377-133683399 GTGGTGGTGGTGGTGGTGGGGGG - Intergenic
1076953472 10:133683380-133683402 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1076955419 10:133742984-133743006 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076956409 10:133746294-133746316 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076957397 10:133749603-133749625 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076958384 10:133752913-133752935 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076958404 10:133752957-133752979 GTGGTGGTGGTGGTGGTGGGGGG - Intergenic
1076958407 10:133752960-133752982 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1076959370 10:133756212-133756234 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076960357 10:133759522-133759544 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
1076960377 10:133759566-133759588 GTGGTGGTGGTGGTGGTGGGGGG - Intergenic
1076960380 10:133759569-133759591 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1077156236 11:1092996-1093018 GTGGTAGTGGTGAAGGTGGTGGG - Intergenic
1077156740 11:1095482-1095504 GTGGTGGTTGTCATGGTGGTGGG - Intergenic
1077156787 11:1095659-1095681 GTGGTGGTGGTGATGGGTGTCGG - Intergenic
1077156820 11:1095797-1095819 GTGGTGGTGGTGATGGATGTCGG - Intergenic
1077156881 11:1096004-1096026 GTGGTGGTGGTGATGGGTGTTGG - Intergenic
1077156957 11:1096280-1096302 GTGGTGGTGGTGATGGATGTCGG - Intergenic
1077156998 11:1096418-1096440 GTGGTGGTGGTGATGGGTGTCGG - Intergenic
1077157304 11:1097492-1097514 GTGGTGGTGGTGATGGCTGTTGG - Intergenic
1077157445 11:1097975-1097997 GTGGTGGTGGTGATGGGTGTCGG - Intergenic
1077157631 11:1098606-1098628 GTGGTGGTGGTGATGGCTGTTGG - Intergenic
1077157831 11:1099296-1099318 GTGGTGGTGGTGATGGCTGTTGG - Intergenic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077289050 11:1780442-1780464 TGGGCGGAGGTGGTGGTGATCGG + Intergenic
1077416980 11:2428569-2428591 GCGGTGGTGGTGATGGTGGTGGG + Intergenic
1077417016 11:2428795-2428817 GTGGTGGTGATGATTGTGGTGGG + Intergenic
1077417284 11:2430457-2430479 GTGGTGGTGGTGGTGGTGGCTGG + Intergenic
1077598748 11:3557614-3557636 GTGGTGGTGGTGGTCGTGGTGGG - Intergenic
1077728842 11:4705974-4705996 GTGGTGGTGGTGGTGGTGGGGGG + Intronic
1078636531 11:13055473-13055495 GTTTGGGAGGTGAAGGTGGTGGG + Intergenic
1078643133 11:13114447-13114469 CTGGGGGAGGTGATGAGGGTGGG - Intergenic
1079135879 11:17775770-17775792 GTGGAGGGGGTGGTGGTGGCCGG + Intronic
1079407337 11:20158224-20158246 GTGGTGGTGGTGGTGGTGCTGGG + Intronic
1079777229 11:24546978-24547000 GTGGTGGTGGTGGTGGTGGTTGG + Intronic
1080088125 11:28310944-28310966 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1081488288 11:43547985-43548007 GGGGCAGAGGTGATGCTGGGCGG + Intergenic
1081774992 11:45670732-45670754 GTTGGGGAGGTGATGGGAGTTGG + Intergenic
1082071617 11:47944020-47944042 GTGGCGGAGGTGGGGAGGGTGGG + Intergenic
1082833786 11:57638233-57638255 GAGGCGGAGGGGATGGGGGTTGG + Intergenic
1084254820 11:67933486-67933508 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1084294315 11:68201178-68201200 GTGGTGGTGCTGGTGGTGGTGGG - Intronic
1084466054 11:69323703-69323725 GTGGTGGTGGTGGTGGAGGTGGG + Intronic
1084466093 11:69323883-69323905 GTGGCGGTGGTAGTGGAGGTGGG + Intronic
1084978690 11:72816950-72816972 GTGGGGGTGGTGGAGGTGGTGGG + Intronic
1084978695 11:72816959-72816981 GTGGAGGTGGTGGGGGTGGTGGG + Intronic
1085531152 11:77192807-77192829 GTGGAGGTAGTGATGATGGTTGG + Intronic
1085689124 11:78651331-78651353 GTGGCTGAGGTGGTGTGGGTGGG + Intergenic
1087188829 11:95231220-95231242 GTGGAGGTGGTGAAGGTGGTGGG - Intronic
1088425056 11:109693446-109693468 GTGCTGGAGGTGATGGTGGTGGG - Intergenic
1088604065 11:111512387-111512409 GTGGGGGAGGGGATGGGGGGGGG - Intergenic
1088996645 11:115006088-115006110 GTGGTGGTGGTGGTGATGGTTGG + Intergenic
1089051923 11:115553069-115553091 GTGGTGGAGGTGGTTGTGTTTGG - Intergenic
1089579456 11:119472299-119472321 GTGGAGGGGGTGGTGGGGGTGGG + Intergenic
1089643700 11:119864336-119864358 CTGGGGGAGGTGGTGGTGTTAGG - Intergenic
1089750588 11:120648495-120648517 GTGGAGGGGGTGATCCTGGTTGG + Intronic
1089796879 11:120987916-120987938 GTGGTGGAGGTGGAGGTGGTTGG - Exonic
1089816608 11:121182322-121182344 GTGCCAGTGGTGGTGGTGGTGGG + Intronic
1090395026 11:126413441-126413463 CTGGCAGAGATGATGGTGGGAGG + Intronic
1090832878 11:130431286-130431308 GTGGCGGCGGCGGCGGTGGTGGG - Intergenic
1091288174 11:134420606-134420628 GCGGCGGTGAGGATGGTGGTGGG - Intergenic
1091599947 12:1912073-1912095 GTGGGGGTTGTGATGGGGGTGGG + Intronic
1091649754 12:2301172-2301194 AGGGCTGAGCTGATGGTGGTTGG + Intronic
1091668787 12:2437941-2437963 GTGGTGGTGGTGGTGATGGTTGG + Intronic
1091668884 12:2438398-2438420 GTGGTGGTGGTGATGGCGGAAGG + Intronic
1091680470 12:2523150-2523172 GGGGCGGTGGTGCTGGTAGTAGG + Intronic
1092210802 12:6645237-6645259 ATGGGGGAGGTCATCGTGGTGGG + Exonic
1092286724 12:7132912-7132934 GTGGAAAAGGTGATGGTGCTGGG + Intronic
1092424883 12:8366955-8366977 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1092655563 12:10680835-10680857 CTGAAGGAAGTGATGGTGGTGGG - Intergenic
1093112311 12:15166562-15166584 TTGGTGGTGGTGGTGGTGGTAGG + Intronic
1093413344 12:18892864-18892886 GTGGTGGTGGTGGTGGTGGTAGG + Intergenic
1093957102 12:25233113-25233135 ATGGTGGTGGTGGTGGTGGTAGG - Intronic
1094003589 12:25723450-25723472 GTGGAGGAGGAGATGGGAGTAGG - Intergenic
1094121843 12:26983231-26983253 GGGGGGGAGGTGGTGGGGGTGGG + Intronic
1094203480 12:27816584-27816606 GTGGAGGAGGAGGTGGTGGGTGG + Intergenic
1094449162 12:30565939-30565961 GTGGCGCAGCTGATCTTGGTTGG + Intergenic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1095866336 12:46976450-46976472 GTGGTGGTGGTGGAGGTGGTAGG + Intergenic
1095939844 12:47718869-47718891 GTGGAGGGGGTGCTGGTGGGGGG - Intronic
1097155063 12:57006421-57006443 GCGGCGGCGGCGATGGTGCTCGG - Exonic
1097323094 12:58246838-58246860 TTGGGGGAGGGGGTGGTGGTGGG + Intergenic
1098250509 12:68564675-68564697 GTGATGGTGGTGATGGTGATGGG - Intergenic
1099088879 12:78279881-78279903 GTGGAGGAGGGCATGGTAGTAGG + Intergenic
1100380232 12:94054942-94054964 GTGGTGGTGATGGTGGTGGTTGG - Intergenic
1100440276 12:94610557-94610579 TTGGTGGTGGTGGTGGTGGTAGG - Intronic
1100773008 12:97944289-97944311 GTGGTGGTGTTGATGGTAGTTGG + Intergenic
1101354745 12:103966224-103966246 GCGGCGGTGGTGGTGGAGGTCGG + Intronic
1101400876 12:104385609-104385631 GTGGTGGTGGTGGTGGTGATGGG - Intergenic
1101716970 12:107319929-107319951 GTGGTGGTGATGGTGGTGGTTGG - Exonic
1101740670 12:107497491-107497513 GTGGTGATGATGATGGTGGTGGG - Intronic
1101865836 12:108518763-108518785 GTGGTAGATGTGATGGTAGTAGG - Exonic
1101981038 12:109407020-109407042 GTGGTGGTGGTGATGGTGATGGG - Intronic
1102002420 12:109565785-109565807 CTGGAGGAGGTGATGCTGGAGGG + Intronic
1102281286 12:111620942-111620964 GTGGGGAGGATGATGGTGGTTGG - Intergenic
1102601292 12:114032643-114032665 GTGGTGGGGGTTGTGGTGGTGGG + Intergenic
1102720194 12:115009240-115009262 GTGGTGGTGGTGATGGTGACGGG - Intergenic
1102837499 12:116079213-116079235 TTGGTGGTGGTGGTGGTGGTGGG + Intronic
1103253198 12:119518712-119518734 TTGGTGGTGGGGATGGTGGTGGG + Intronic
1103459278 12:121090793-121090815 CTGGCAGAGGTGATGATGGGAGG + Intergenic
1103565678 12:121814288-121814310 GTGGGGGTGGTGGTGGTGGGGGG - Exonic
1103565681 12:121814291-121814313 GCGGTGGGGGTGGTGGTGGTGGG - Exonic
1103601958 12:122059994-122060016 GTGATGGGGGTGGTGGTGGTGGG - Exonic
1103812442 12:123626385-123626407 GTGGGGGAGGTGATTATGGCTGG + Intronic
1104050552 12:125190968-125190990 GTGGTGATGGTGATGGTGATGGG + Intronic
1104050637 12:125191230-125191252 GTGGTGATGGTGATGGTGATGGG + Intronic
1104058300 12:125246912-125246934 GTGGGGGAGGTGGTGGGGGTAGG + Intronic
1104315524 12:127696656-127696678 TTGGTGGAGGTGATGGTGATGGG + Intergenic
1104950877 12:132439379-132439401 TTGGCGGCAGGGATGGTGGTAGG - Intergenic
1104951957 12:132445183-132445205 GTGGAGGAGAAGATGGTGTTTGG - Intergenic
1105676717 13:22679712-22679734 GTGGTGGTGGTGAAGGTGATGGG - Intergenic
1106292258 13:28374890-28374912 GTGGTGGTGGTAGTGGTGGTGGG - Intronic
1106995427 13:35475519-35475541 GTGGCGGAGGTCAAGGCGGAAGG - Exonic
1107839074 13:44436979-44437001 GGGGCGGAGGTGGGGGTGGGGGG - Intronic
1107986947 13:45783917-45783939 GTGGTGAAGGTGGTGGGGGTGGG + Exonic
1108063284 13:46553473-46553495 ATGGTGGTGGTGGTGGTGGTGGG - Exonic
1108272792 13:48778831-48778853 AGGGCGGGGGTGGTGGTGGTGGG - Intergenic
1108588820 13:51894497-51894519 GGGGATGAGGCGATGGTGGTTGG + Intergenic
1109225741 13:59692683-59692705 TTGATGGAGGTGGTGGTGGTGGG - Intronic
1109821382 13:67660364-67660386 GTGGTGGTGGTGGTGGTGGTAGG + Intergenic
1110195060 13:72779751-72779773 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1110195063 13:72779754-72779776 GTGGTGGTGGTGGTGGTGGGGGG + Intronic
1110814783 13:79849166-79849188 GTGGGGGAGGTGGCGGTGGAAGG + Intergenic
1111374506 13:87361121-87361143 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1111644985 13:91021521-91021543 GTGTCTGTGGTGATGGTGGTGGG - Intergenic
1112092646 13:96098356-96098378 GTGGCTGAGGTGGTGGTGGTTGG + Intronic
1112394237 13:99013944-99013966 GTGGCAGAGGTGCTGCTGGATGG - Intronic
1112507339 13:99982753-99982775 GTGGTGGTGGTGGTGGTGGTGGG - Exonic
1113707260 13:112442919-112442941 GTGGAGGAGGTGGTGCTGCTGGG - Intergenic
1113823481 13:113232139-113232161 GTGGCAGCAGTAATGGTGGTGGG - Intronic
1113823489 13:113232171-113232193 GTGGCAGCAGTAATGGTGGTGGG - Intronic
1113823497 13:113232203-113232225 GTGGCAGCAGTAATGGTGGTGGG - Intronic
1113823505 13:113232235-113232257 GTGGCAGCAGTAATGGTGGTGGG - Intronic
1114051153 14:18920584-18920606 GTGGCGGGGGTGGTGGAGGGAGG + Intergenic
1114111409 14:19481341-19481363 GTGGCGGGGGTGGTGGAGGGAGG - Intergenic
1115028374 14:28767413-28767435 GTGGTGGTGGTGGTGGTGCTGGG - Exonic
1115144456 14:30210388-30210410 GCGGTGGTGGTGGTGGTGGTGGG - Intergenic
1116547440 14:46186556-46186578 GTGGCGGGGGTGAGGCTGGAGGG - Intergenic
1117200450 14:53384714-53384736 GTGGAGGAGGTGATTGGGGGAGG - Intergenic
1117254677 14:53965604-53965626 GTGGTGGCGGTGATGGGGGTGGG - Intergenic
1117547578 14:56805715-56805737 GTGGGGGTGGGGATGGGGGTGGG - Intronic
1117602677 14:57390993-57391015 GGGCCGGAGGTGCTGGTGGTGGG - Exonic
1117772048 14:59143315-59143337 GGGGAGGAGGTGAGGGTGGCGGG - Intergenic
1117935092 14:60894699-60894721 TTGGTGGTGGTGGTGGTGGTAGG + Intronic
1118244103 14:64091647-64091669 GTGGTGGCGGTGGTGGTGGTTGG + Intronic
1118473346 14:66094672-66094694 GAGGCGTAGGTGGTGGTGGCAGG - Intergenic
1118600657 14:67469652-67469674 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1118600658 14:67469655-67469677 GTGGTGGTGGTGGTGGTGGGAGG + Intronic
1118747780 14:68786352-68786374 GAGGTGGTGGTGGTGGTGGTTGG - Intergenic
1119041501 14:71278651-71278673 GTGCATGTGGTGATGGTGGTGGG + Intergenic
1119409875 14:74423873-74423895 GTGGTGGTGGTGGTGGTGGCAGG + Intronic
1120487965 14:85138488-85138510 GTGGTGGTGGTGGTGGTGGGTGG + Intergenic
1120578829 14:86220958-86220980 GTGGCGGAGCTGGAGGTGGGTGG + Intergenic
1120834633 14:89028592-89028614 GTGGTGGTGGTGGTGGTGGAAGG - Intergenic
1120874034 14:89361435-89361457 GTGCTGGAGGTGGTAGTGGTAGG - Intronic
1121222912 14:92299791-92299813 GAGGTGGAGGTGATGATGGGAGG + Intergenic
1121283813 14:92719116-92719138 GTGGCGGTGGTTGTGGTGGTGGG - Intronic
1121446905 14:93984719-93984741 GAGACAGAGGGGATGGTGGTTGG + Intergenic
1121694866 14:95904347-95904369 GTGGAGGATGTGCTGGTGATAGG + Intergenic
1121792372 14:96708950-96708972 GTGGTGGCGGTGGTGGTGGCAGG + Intergenic
1121792384 14:96709013-96709035 GTGGTGGCGGTGGTGGTGGCAGG + Intergenic
1121792396 14:96709076-96709098 GTGGTGGCGGTGGTGGTGGCAGG + Intergenic
1121792408 14:96709141-96709163 GTGGTGGCGGTGGTGGTGGCAGG + Intergenic
1121792420 14:96709204-96709226 GTGGTGGCGGTGGTGGTGGCAGG + Intergenic
1121792438 14:96709296-96709318 GTGGTGGCGGTGGTGGTGGCAGG + Intergenic
1121792456 14:96709388-96709410 GTGGTGGCGGTGGTGGTGGCAGG + Intergenic
1121893070 14:97616033-97616055 GTGCCAGTGGTGATGGTGGTGGG + Intergenic
1122176894 14:99927781-99927803 GTGGTGGTGGTATTGGTGGTGGG + Intronic
1122177033 14:99928227-99928249 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1122342722 14:101038647-101038669 GTGGTGGTGGTGGTGGTGGAGGG + Intergenic
1122769565 14:104091973-104091995 GTGGCAGAGTTGCTGGGGGTGGG + Intronic
1122885222 14:104707725-104707747 GTGGTGGAGGTGGTGGGGGCAGG - Exonic
1123058607 14:105584245-105584267 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123082938 14:105704479-105704501 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123899642 15:24863390-24863412 GTGGCAGCAATGATGGTGGTGGG + Intronic
1124466991 15:29949031-29949053 GTGGCGGAGGTGATGGTGGTGGG - Intronic
1125320657 15:38484394-38484416 GTAGAGGAGGTGGTGGGGGTGGG + Exonic
1125631257 15:41149066-41149088 GAGGCGGAGGTGGTGGTGAGTGG - Intergenic
1126330594 15:47526689-47526711 TTGGTGGTGGTGATGGTGGTTGG + Intronic
1126551479 15:49935618-49935640 GGGGCTGTGGTGATGGAGGTGGG - Intronic
1127184522 15:56464576-56464598 GTGGTGGTGGTGGTGGTGGGTGG - Intronic
1127184523 15:56464579-56464601 GTCGTGGTGGTGGTGGTGGTGGG - Intronic
1127310763 15:57750214-57750236 GGGGCGGAGGTTCTGCTGGTAGG - Intronic
1127490332 15:59456309-59456331 CTGGAGCAGGTGATTGTGGTAGG + Intronic
1128316560 15:66662976-66662998 GGTGCGGAGGTGGGGGTGGTGGG - Intronic
1128898559 15:71398274-71398296 GGGGAAGAGGTGATGGTGGGAGG + Intronic
1129016728 15:72474887-72474909 GCGGCGGCGGTGGTGGTGGCGGG + Exonic
1129235505 15:74221597-74221619 GGTGGGGAGGTGATGGTGGGAGG + Intergenic
1129600258 15:76994609-76994631 GTGGTGGCGGTGGTGGTGGTGGG + Intronic
1129756413 15:78101709-78101731 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1129868979 15:78928974-78928996 TGGGCGGAGGTGATGGTGGGAGG + Intronic
1130978757 15:88797831-88797853 GTGGTTGTGATGATGGTGGTGGG + Intergenic
1131356227 15:91749352-91749374 GTGGAGGTGGAGGTGGTGGTGGG + Intergenic
1131356471 15:91750255-91750277 GTGGTGGAGGTGGAGGTGGTTGG + Intergenic
1131356592 15:91750827-91750849 GTGGTGGTGGTGGTGGTGGTAGG + Intergenic
1131356603 15:91750869-91750891 GTGGTGGAGGTGGAGGTGGTAGG + Intergenic
1131356623 15:91750953-91750975 GTGGTGGAGGTGGTGGTGGTAGG + Intergenic
1131356634 15:91750995-91751017 GTGGTGGAGGTGGTGGTGGTAGG + Intergenic
1131356645 15:91751037-91751059 GTGGTGGAGGTGGTGGTGGTAGG + Intergenic
1131568918 15:93512669-93512691 GTGGTGGTGGTGGTGGTAGTAGG + Intergenic
1131675622 15:94667446-94667468 GTGAAGGAGGCGGTGGTGGTAGG - Intergenic
1131815711 15:96219069-96219091 GTGGAGGAGGGGATGGTGTGGGG + Intergenic
1132074696 15:98810146-98810168 CTGGCGGAGGGGGTGGTGGGTGG + Intronic
1132117114 15:99145575-99145597 GAGGTGGTGGTGGTGGTGGTGGG + Intronic
1132206202 15:99987809-99987831 GAGGGGCAGGTGGTGGTGGTGGG + Intronic
1132292029 15:100710521-100710543 ATGGTGGAGGTGGAGGTGGTGGG + Intergenic
1132500409 16:282390-282412 TGGGCGGAGGGGATGGGGGTGGG + Intronic
1132992548 16:2804378-2804400 GTGGCAGAGGTGCTGGAGATAGG - Intergenic
1133234563 16:4381925-4381947 GTGGCTGTGGTGGTGGTGGCTGG - Exonic
1133313600 16:4867763-4867785 GTGGGGGAGATGATGGTGAGGGG + Intronic
1133373358 16:5263077-5263099 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
1133594310 16:7275936-7275958 GTGGTGGTGGTGGTGGTGTTTGG - Intronic
1133598727 16:7318363-7318385 GTGGTGGTGGTGATGATGTTTGG + Intronic
1133768487 16:8854351-8854373 GGGGCTGGGGTGGTGGTGGTGGG - Exonic
1134301394 16:12994531-12994553 GTGGTGGTGGTAGTGGTGGTGGG + Intronic
1134641502 16:15832778-15832800 GAGCAGGAGGTGATGGTCGTGGG - Intronic
1134763966 16:16739535-16739557 GTGGAGGAGGTGGAGGTGATAGG + Intergenic
1135631120 16:24036216-24036238 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1135922160 16:26660706-26660728 GTGGTCGTGGTGGTGGTGGTGGG - Intergenic
1135933307 16:26757770-26757792 CTGGCTTAGGTGATGGGGGTTGG + Intergenic
1135977157 16:27116067-27116089 GGGGCGGAGGTCAGGGTGTTGGG - Intergenic
1136020578 16:27437428-27437450 GGGGCAGGGGGGATGGTGGTGGG - Intronic
1137366314 16:47862670-47862692 CTGCAGGAGGTGATGGTGGCTGG + Intergenic
1137997654 16:53236616-53236638 GTGGTGGTGGTGGTGGTGGGGGG - Intronic
1138118795 16:54381533-54381555 GGGGTGGTGGTGATGGTGTTGGG + Intergenic
1138128594 16:54458925-54458947 GTGGGGGTGGTAAGGGTGGTGGG - Intergenic
1138360257 16:56422429-56422451 GGGGAGGAGGTGAAGGAGGTGGG - Intronic
1139069289 16:63360278-63360300 GTGACAGTGGTGATGATGGTGGG - Intergenic
1139136084 16:64206230-64206252 GTGGTGGAGGGGGTGGGGGTGGG + Intergenic
1139978792 16:70836486-70836508 GAGGGAGAGATGATGGTGGTTGG + Intronic
1140053213 16:71501476-71501498 GTTTGGGAGGTGAGGGTGGTTGG + Intronic
1140124053 16:72105731-72105753 GTGGAAGTGGTGGTGGTGGTGGG + Intronic
1140431995 16:74912217-74912239 ATGGTGGATGTGATGGTTGTGGG + Exonic
1140643365 16:77002827-77002849 GTGGCAGTGGTGATGATGGCTGG - Intergenic
1140712269 16:77689450-77689472 GCAGCTGAGGTGGTGGTGGTGGG - Intergenic
1141251583 16:82363751-82363773 CTGGTGGGGGTGGTGGTGGTAGG + Intergenic
1141659680 16:85435299-85435321 GTGGGGGAGGGGGTGGTGGGAGG - Intergenic
1142087734 16:88193129-88193151 GTGATGGTGGTGATGGTGGTGGG + Intergenic
1142087741 16:88193150-88193172 GGGATGGTGGTGATGGTGGTGGG + Intergenic
1142087752 16:88193186-88193208 GTGGTGGTGGTGATGGTGGTGGG + Intergenic
1142087779 16:88193279-88193301 GTGGTGGAGATGGTGGTGGTGGG + Intergenic
1142143127 16:88481409-88481431 GTGGTGGGGGTGGGGGTGGTGGG - Intronic
1142286488 16:89173503-89173525 CTGGGGGAGGTGGTGGAGGTGGG + Intronic
1142642924 17:1295197-1295219 GTGGAGGAGGTGGCGGTGGCAGG - Intronic
1142696832 17:1638629-1638651 GGGTCAGAGGTGATGGGGGTGGG - Intronic
1142696850 17:1638676-1638698 GGGTCAGAGGTGATGGGGGTGGG - Intronic
1142703887 17:1682082-1682104 GTGGTGGTGGTGGTGGTGGTTGG - Intronic
1142759878 17:2035977-2035999 GAGGCCGAAGTGATGGTGATGGG + Exonic
1142832714 17:2561253-2561275 GGGGCGGAGGGGATGGTTTTTGG - Intergenic
1143037487 17:4007656-4007678 GTGGCGGCGGCAATGCTGGTAGG + Intronic
1143121097 17:4607392-4607414 GTGGAGGACATGATGGTGATGGG + Exonic
1143130084 17:4672452-4672474 GCGGCGGAGGTGGGGGTGGCGGG + Exonic
1143172951 17:4940593-4940615 GTGGCGGAGCTCAAGGAGGTGGG - Exonic
1143248484 17:5504922-5504944 TTGGTGGTGGTGGTGGTGGTGGG + Intronic
1143252887 17:5535920-5535942 GTGGTGGTGGTGAGGGTGGTGGG + Intronic
1143338893 17:6194048-6194070 GTGGTGGTGGTGGTGGTGATGGG + Intergenic
1143338917 17:6194132-6194154 GTGGAGGTGGTGGTGGTGATGGG + Intergenic
1143338988 17:6194360-6194382 GGGGTGGTGGTGATGGTGATGGG + Intergenic
1143338999 17:6194390-6194412 GTGATGGGGGTGATGGTGATGGG + Intergenic
1143468621 17:7156450-7156472 GTGGAGGCGGTGTTGGCGGTGGG - Intergenic
1143523967 17:7462020-7462042 TTGGGGGAGGTGGTGTTGGTGGG + Exonic
1143660674 17:8322701-8322723 GTGGTTGTGGCGATGGTGGTGGG + Intergenic
1143700891 17:8659238-8659260 GTGGAGGCAGTGGTGGTGGTGGG + Intergenic
1143703950 17:8683602-8683624 GTGTGTGTGGTGATGGTGGTGGG - Intergenic
1143770595 17:9166146-9166168 GTGGTGGTGGTGGTGGTGGAAGG - Intronic
1144572365 17:16407808-16407830 GAGGCAGAGGTGAGGGTGGGAGG + Intergenic
1144765846 17:17731986-17732008 CTGGGGGAGGTGGTGGTGGGGGG + Intronic
1144892340 17:18501194-18501216 CTGGGGGAGGTGCTGGTGGCTGG - Intergenic
1145139874 17:20443094-20443116 CTGGGGGAGGTGCTGGTGGCTGG + Intergenic
1145261206 17:21355838-21355860 GTGGGGGAGGTGGCAGTGGTGGG - Intergenic
1145745770 17:27318599-27318621 GTGGTGGTGGTGGTGGTCGTGGG - Intergenic
1145786505 17:27597310-27597332 GTGGAGGAGGTGGTGGAGGAAGG - Exonic
1145970977 17:28956374-28956396 GTGGCGATGGTGTTGTTGGTAGG - Exonic
1146142554 17:30379824-30379846 GTGGCGGTGGTGAAGGTGAAGGG + Intronic
1146619615 17:34387297-34387319 CTGCCGGTGGTGGTGGTGGTGGG - Intergenic
1146924643 17:36735948-36735970 GTGTCGGAGGTGAGATTGGTGGG + Intergenic
1147153983 17:38533965-38533987 GTGGTGGTGGTGGTGGTGGACGG - Intronic
1147332854 17:39709142-39709164 GTTGCGGGTGTGGTGGTGGTGGG + Intronic
1147334102 17:39716440-39716462 GGGGCGGAGGAGAGGGTGGCTGG + Intronic
1147575759 17:41598321-41598343 GTGGTGGTGGTAGTGGTGGTGGG + Intergenic
1147575772 17:41598366-41598388 GTGGTGGTGGTAGTGGTGGTGGG + Intergenic
1147575794 17:41598438-41598460 ATGGTGGGGGTGATGGTGGTGGG + Intergenic
1147575826 17:41598557-41598579 ATGGTGGGGATGATGGTGGTGGG + Intergenic
1147575865 17:41598717-41598739 ATGGTGGGGGTGATGGTGGTGGG + Intergenic
1147575918 17:41598930-41598952 ATGGTGGGGGTAATGGTGGTGGG + Intergenic
1147576000 17:41599325-41599347 ATGTTGGTGGTGATGGTGGTGGG + Intergenic
1147576018 17:41599402-41599424 GTGGTGGTGGTCATGGTGGTGGG + Intergenic
1147864383 17:43543180-43543202 AAGGCGGAGGTGAGGGGGGTGGG - Intronic
1148083910 17:44982742-44982764 GTGGAGGTGGTGATGGTGTTGGG + Intergenic
1148460112 17:47834897-47834919 TTGGTGGTGGTGGTGGTGGTTGG + Intronic
1148560331 17:48602383-48602405 GTGGGGGTGGGGATGGCGGTGGG + Intronic
1149374668 17:56031985-56032007 GTGCAGGAGGTGAGGATGGTGGG + Intergenic
1149456538 17:56792879-56792901 GTGGTGGTGGTGATGGTGGTGGG + Intronic
1149512695 17:57256448-57256470 GAGGAGGAGGAGATGGGGGTGGG + Intronic
1149648370 17:58257257-58257279 GGGGCGGAGGTGGAGATGGTTGG - Intronic
1150137142 17:62702244-62702266 GTGGAGGAGGTGGAGTTGGTGGG + Intronic
1150148693 17:62792589-62792611 TTGATGGAGGTGGTGGTGGTGGG - Intronic
1150148864 17:62793287-62793309 GTGATGGAGGTGGTGGTGGTGGG - Intronic
1150336099 17:64331880-64331902 GTGGTGGAGGGAATGGTGGGAGG + Intronic
1150386436 17:64765320-64765342 GTGGCGGAGGAGATGGAGCCTGG - Intergenic
1150760854 17:67959660-67959682 GAGGGGGAGGTGAAGGTGGAGGG - Exonic
1151050550 17:70973642-70973664 GTGGTGGTAGTGGTGGTGGTGGG - Intergenic
1151441031 17:74129307-74129329 GTGGCGGGGGTGGTGGCGGGAGG - Intergenic
1151935255 17:77257315-77257337 ATGGAGGAGGTGATGGGGATGGG - Intergenic
1151976104 17:77484264-77484286 ATGGTGGTGGTGATAGTGGTGGG + Intronic
1151976284 17:77485131-77485153 GTGGTGGTGGTGATTGTGATGGG + Intronic
1152103181 17:78314472-78314494 CTGGAGGAGGTGCTGGGGGTGGG + Intergenic
1152204518 17:78967416-78967438 GTGACGGAGGTGACGGAGGTGGG + Intergenic
1152279235 17:79375634-79375656 GTGGCTGCAGTGATGGAGGTGGG + Intronic
1152361322 17:79834457-79834479 GTGGTGGTGGTGGTGGTGATGGG + Exonic
1152553728 17:81042715-81042737 ATGGGGGTGGGGATGGTGGTGGG + Intronic
1154290983 18:13106507-13106529 GTGGTGGTGGTGGTGGTGGTAGG - Intronic
1155559846 18:27063872-27063894 GTGGGGGTGGTGAAGGTGGGAGG + Intronic
1155563083 18:27101483-27101505 CTGGCGGGGGTGAGGGTGGGCGG + Intronic
1155872129 18:31042240-31042262 GAGCTGGTGGTGATGGTGGTTGG - Intronic
1157060191 18:44279079-44279101 GTGGCGAGGGTGGGGGTGGTAGG - Intergenic
1157202503 18:45671262-45671284 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
1157383975 18:47247201-47247223 GTGAGGGTGGTGATGGTGGTGGG + Intronic
1157480358 18:48050013-48050035 GTGGCTGAGGTGGGGGTGGGAGG + Intronic
1157562430 18:48657948-48657970 GAGCCAGAGGTGAGGGTGGTGGG + Intronic
1157569588 18:48703760-48703782 GTGGTGGTGGTGGTGGTGGAGGG - Intronic
1157615090 18:48982003-48982025 GGGGAGGAGGTGAGGGTGATGGG + Intergenic
1158332570 18:56378991-56379013 GGGGCTGAAGTGATGGGGGTAGG + Intergenic
1158526928 18:58223427-58223449 GTGGATGTGGTGATGGTGGGGGG + Intronic
1158650060 18:59276163-59276185 GGGGTGGTGGTGATGGGGGTGGG + Intronic
1158714562 18:59866544-59866566 GAGGCAGAGGTGATGGGGGGGGG - Intergenic
1159916603 18:74193770-74193792 GTGGAGGGGGGGATGGTGGAGGG - Intergenic
1160063421 18:75552064-75552086 GTGGTGGAGGAGAAGGGGGTGGG + Intergenic
1160257249 18:77258470-77258492 TTGGTGGTGGTGATGGTGGTGGG + Intronic
1160257464 18:77259492-77259514 GTGGTGGTGGTGATGGTGGTGGG + Intronic
1161021487 19:2013579-2013601 GTGGCGGAGCTGGAGGTGGGTGG + Intronic
1161151636 19:2713175-2713197 GTGGAGGAGGCGATGGGTGTAGG - Intergenic
1161151648 19:2713219-2713241 GTGGAGGAGGTGATGGGTGTAGG - Intergenic
1161151660 19:2713263-2713285 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151672 19:2713307-2713329 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151685 19:2713351-2713373 GTGGAGGAGGTGATGGGTGTAGG - Intergenic
1161151706 19:2713439-2713461 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151716 19:2713483-2713505 GTGGAGGAGGTGATGGGTGTAGG - Intergenic
1161151750 19:2713615-2713637 GTGGAGGAGGTGACGGGTGTAGG - Intergenic
1161151761 19:2713659-2713681 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151774 19:2713703-2713725 GTGGAGGAGGTGACGGGTGTAGG - Intergenic
1161151786 19:2713747-2713769 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151799 19:2713791-2713813 GTGGAGGAGGTGACGGGTGTAGG - Intergenic
1161151811 19:2713835-2713857 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151824 19:2713879-2713901 GTGGAGGAGGTGACGGGTGTAGG - Intergenic
1161151835 19:2713923-2713945 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151847 19:2713967-2713989 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151860 19:2714011-2714033 GTGGAGGAGGTGATGGGTGTAGG - Intergenic
1161151887 19:2714099-2714121 GTGGAGGAGGTGATGGGTGTAGG - Intergenic
1161151910 19:2714187-2714209 GTGGAGGAGGTGGTGGGTGTAGG - Intergenic
1161151924 19:2714231-2714253 GTGGAGGAGGTGACGGGTGTAGG - Intergenic
1161151962 19:2714363-2714385 GTGGAGGAGGTGATGGGTGTAGG - Intergenic
1161151974 19:2714407-2714429 GTGGAGGAGGTGATGGGTGTAGG - Intergenic
1161151986 19:2714451-2714473 GTGAAGGAGGTGATGGGTGTAGG - Intergenic
1161165592 19:2785552-2785574 GTGGCGGCGGTGGCGGCGGTTGG + Exonic
1161178071 19:2859700-2859722 GTGCTGGTGGTGGTGGTGGTGGG - Exonic
1161606028 19:5215457-5215479 GAGGCCGAGGTGATGAGGGTGGG + Intronic
1161607892 19:5224985-5225007 GTGGTGGTGGTGGTGGTGGGCGG - Intronic
1162153794 19:8663424-8663446 GTGGAGGGGGAGCTGGTGGTGGG + Intergenic
1162525612 19:11204428-11204450 CTGGAGGAGGTGATGGAGGGTGG - Intronic
1162688946 19:12412958-12412980 GAGGCAGAGGTGATGGTGAGCGG + Intronic
1162824227 19:13241656-13241678 GTGGGGGTGGTGGTGGCGGTGGG + Intronic
1162830089 19:13278930-13278952 TGGGCAGAGGGGATGGTGGTGGG + Intronic
1162857490 19:13480222-13480244 GTGGCAGAGGTGGAGGTGGAAGG - Intronic
1162938457 19:13993786-13993808 GTGGCGGCTGGGATGGTGGCGGG + Exonic
1163019524 19:14474962-14474984 GAGGCAGAGGTGATCGGGGTAGG - Intronic
1163195392 19:15716077-15716099 ATGGTGGTGGTGGTGGTGGTGGG + Intergenic
1163208978 19:15826410-15826432 ATGGTGGTGGTGGTGGTGGTTGG - Intergenic
1163228074 19:15979119-15979141 GTGGAGGAGGGAATGGTGGGAGG + Intergenic
1163237943 19:16040188-16040210 GTGGCGGGGGTGGGGGTGGGGGG - Intergenic
1163371866 19:16905654-16905676 GAGTGGGAGGTGGTGGTGGTGGG - Intronic
1163440263 19:17319215-17319237 GTGGGGCAGGTCCTGGTGGTAGG + Intronic
1163525241 19:17816938-17816960 GTGGTGGCGGTGATGGTGAGAGG + Exonic
1164478526 19:28593643-28593665 GTGGTGATGGTGATAGTGGTGGG - Intergenic
1164658355 19:29940963-29940985 GTTCCAGAGGTGATGATGGTTGG + Intronic
1165065008 19:33223921-33223943 ATGGTAGAGGTGGTGGTGGTGGG - Intronic
1165268418 19:34681525-34681547 GTGGTGGAGGTGATGGTTTGGGG + Intronic
1165838019 19:38771101-38771123 GTGGCGGAAGTGGTGGTACTGGG + Exonic
1165841546 19:38791596-38791618 GTGGCGGAAGTGGTGGTACTGGG - Exonic
1165861225 19:38910614-38910636 GTGGTGGTGGTGGTGGTGGTGGG + Exonic
1165899986 19:39164870-39164892 GTGGTGGTGGCGATGGTGGTGGG + Intronic
1165948259 19:39458231-39458253 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
1166210828 19:41305732-41305754 GTGGTGGAGGTGGAGGCGGTGGG - Exonic
1166384960 19:42375824-42375846 GTGGTGGAGGTGGTGGGGCTGGG - Exonic
1166647516 19:44543177-44543199 GGGGAGGTGGTGGTGGTGGTAGG - Intergenic
1166810167 19:45509517-45509539 CTGGTGGTGGTGGTGGTGGTGGG - Intronic
1166812413 19:45522374-45522396 GAGGGGGAGGTCCTGGTGGTGGG - Exonic
1166874817 19:45890868-45890890 GTGGCGGTGGGGGTGGGGGTGGG + Exonic
1167131566 19:47589612-47589634 ATGGCGGATGGGATGGTGTTGGG + Intergenic
1167301499 19:48680475-48680497 CTGGCGGAGGTGGTGGTAGAAGG - Intergenic
1167305055 19:48703420-48703442 CTGGCGGAGGTGGTGGTAGAAGG - Exonic
1167455457 19:49595229-49595251 GTGGCGGGGGTGGTGGGGGCTGG - Exonic
1167509549 19:49888800-49888822 GTTGAGGAGGGGATGGTGGCTGG + Intergenic
1167517634 19:49932609-49932631 GTGGCGGCGGGGAGGGTGGTGGG - Exonic
1167606205 19:50482222-50482244 GTGGGGGTGGGGGTGGTGGTGGG + Exonic
1168020673 19:53606643-53606665 GTGGAGGCGGTGAGGGTGGAGGG + Intergenic
1168322335 19:55517835-55517857 GTGGAGTGAGTGATGGTGGTGGG - Exonic
1168322384 19:55518015-55518037 GTGGAGTGAGTGATGGTGGTGGG - Exonic
1168351745 19:55679995-55680017 GTGGCTGGGGTGATGCTGCTGGG + Intronic
1168501498 19:56897088-56897110 GAGGCGGTGGTGGTGGAGGTGGG + Intergenic
1168527903 19:57103467-57103489 GTGCAGGAGATGACGGTGGTGGG - Intergenic
1168667926 19:58218329-58218351 GTGGTAGTGGTGATGATGGTAGG + Intergenic
1202702810 1_KI270713v1_random:1103-1125 GTGGCGGTGGTGGTGGTGGTGGG - Intergenic
925003481 2:424656-424678 GTGGTGGAGGTGGTGGAGGTGGG - Intergenic
925366653 2:3315768-3315790 GGGATGGTGGTGATGGTGGTAGG - Intronic
925366775 2:3316132-3316154 ATGGTGGTGGTGATGGTGGTGGG - Intronic
925425893 2:3748383-3748405 GTGGGGGAGGTGATGCGGGAGGG + Intronic
925665967 2:6256688-6256710 GTGGTGGTGGTGGTGGTGGGTGG - Intergenic
925665968 2:6256691-6256713 TTGGTGGTGGTGGTGGTGGTGGG - Intergenic
925903705 2:8526489-8526511 TGGGCGGTGGTGGTGGTGGTGGG - Intergenic
926641508 2:15243068-15243090 GTGGTGGCAGTGAAGGTGGTAGG - Intronic
926660672 2:15462612-15462634 GTGGAGGAGGTGAGGGAGGGAGG + Intronic
926701531 2:15807427-15807449 GTGGGGGTGGGGATGGTGGTAGG - Intergenic
926702610 2:15813758-15813780 GTGGGGGTGGGGATGGGGGTGGG + Intergenic
926783540 2:16497969-16497991 GTGGTGGGGGTGGGGGTGGTGGG + Intergenic
926971992 2:18475699-18475721 GCGGTGGTGGTGATGATGGTGGG + Intergenic
927432718 2:23040666-23040688 GTGGTGGTAGTGGTGGTGGTGGG - Intergenic
927916928 2:26943069-26943091 GTGGAGGAGGTGCTGGGGGCTGG + Intronic
928042213 2:27890281-27890303 GTGGCGGCGGTGGTAGTGGTGGG - Exonic
928238294 2:29564432-29564454 GTGGCGGTGGGGGTGGTGGTAGG - Intronic
928949934 2:36805509-36805531 GTGGTGGTGGTGATGGTGGATGG + Exonic
929821876 2:45280810-45280832 GTGGTGGTGGTGGTGGTTGTCGG - Intergenic
930565830 2:53019561-53019583 GTGGTGATGGTGATGGTGGTGGG + Intergenic
931064456 2:58569925-58569947 GGTGCGGTGGTGGTGGTGGTGGG + Intergenic
931098437 2:58968501-58968523 GTGGTGGTGGTGATGATGGTAGG + Intergenic
933289336 2:80420454-80420476 GTGGTGGTGGTGGTGGTGGTAGG - Intronic
933658695 2:84909183-84909205 GTGGCAGTGGTGGTAGTGGTTGG - Intergenic
933729088 2:85443964-85443986 CTGGGCGAGGTGGTGGTGGTTGG + Intergenic
933767495 2:85720038-85720060 GTTGTGGTGGTGATGGGGGTAGG - Intergenic
934044889 2:88164759-88164781 GAGGTGGAGGTGGTGGTGGTGGG + Intergenic
934505558 2:94889910-94889932 GTGAGGTAGGTGGTGGTGGTTGG - Intergenic
934539982 2:95165852-95165874 GTGCCGGAGGTGAGGGTTGTGGG + Exonic
935103197 2:100016219-100016241 GTAGTGGCGGTGATGGTGGTGGG + Intronic
935240236 2:101171596-101171618 GGGGCGGGGGTGGTGGTGGGAGG - Intronic
935592755 2:104856313-104856335 GTGGTGGTGGTGGTGGTGCTCGG - Exonic
935625049 2:105165306-105165328 GTGGTGCAGGGGATGGTGGGAGG - Intergenic
936058947 2:109282036-109282058 GTGTCAGAGGGGATGCTGGTGGG + Intronic
936437827 2:112523156-112523178 GTGGTGGTGGTAATGGTGGTGGG - Intronic
936469228 2:112783794-112783816 CTGGCTGAGCTGATGGTGGCTGG - Intronic
937272188 2:120660125-120660147 GGGGGAGAGGTGATAGTGGTGGG - Intergenic
937389012 2:121466517-121466539 GTGGTGGTGGGGATAGTGGTGGG - Intronic
937953954 2:127408651-127408673 GGGGCGAGGGTGAAGGTGGTTGG - Intergenic
937993189 2:127675250-127675272 GTTGGGGAGGTGACGGTGGGAGG + Intronic
938076539 2:128341241-128341263 GTGGTGCTGGTGCTGGTGGTGGG + Intergenic
938194011 2:129309961-129309983 GTGGTGGTGGTAGTGGTGGTAGG + Intergenic
938235022 2:129699005-129699027 GTGGGGGAGGTGTTGGAGGCTGG - Intergenic
938579530 2:132633830-132633852 GTGGAGGTGATGATGTTGGTGGG + Intronic
938579569 2:132634035-132634057 GTGGAGGTGATGATGATGGTGGG + Intronic
938809760 2:134842470-134842492 GTAGCAGTGGGGATGGTGGTAGG - Intronic
939630552 2:144522937-144522959 GTGGCAGAGGTGATGGGGTCGGG + Intronic
939680787 2:145129519-145129541 GTGGCAGAGGTGGAGGAGGTTGG - Intergenic
941017345 2:160372342-160372364 GTGGTCGTGGTGGTGGTGGTGGG - Intronic
941285847 2:163611144-163611166 GTGGCGGAGGAGGTGGTGGTGGG + Exonic
941405705 2:165084595-165084617 GCGGAGGAGGAGATGATGGTGGG + Intergenic
942506416 2:176646164-176646186 ATGGGGTAGGTGGTGGTGGTTGG + Intergenic
944068854 2:195647690-195647712 GTGGTGGTGGTGGTGGTGGATGG - Intronic
944237626 2:197454267-197454289 GTGGGGGTGGAGATGGAGGTCGG + Intronic
944524859 2:200608736-200608758 GTGGTGGTGGTGATGAAGGTGGG - Intronic
944821872 2:203440357-203440379 TGGGTGGAGGTGGTGGTGGTGGG + Exonic
944881994 2:204022702-204022724 GTTGGCGAGGGGATGGTGGTGGG - Intergenic
946167509 2:217873991-217874013 GCGGGGGTGGTGGTGGTGGTGGG - Intronic
946325779 2:218984187-218984209 GCGGCGGAGGCGAGGTTGGTTGG - Intronic
946329681 2:219002158-219002180 GGGGCGGAGGGGAGGGTGCTGGG + Intergenic
946563224 2:220936487-220936509 GAGGTGGTGGTGGTGGTGGTGGG - Intergenic
946868615 2:224065527-224065549 ATGGTGGTGGTGGTGGTGGTTGG + Intergenic
947798551 2:232910454-232910476 GTGGGGGGGGTAATGGGGGTGGG + Intronic
947817036 2:233044513-233044535 GGGTGGGAGGTGATGGTGGCAGG + Intergenic
948015154 2:234682997-234683019 GTGATGGTGGTGGTGGTGGTGGG + Intergenic
948024947 2:234769365-234769387 GTGGGGCAGGTGATGGAGGGAGG - Intergenic
948075591 2:235163041-235163063 ATGGCGGGGGTGCTGGTGGCGGG + Intergenic
948306316 2:236949616-236949638 GTGGTGGTGGTGGTGGGGGTGGG - Intergenic
948413714 2:237784948-237784970 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
948920469 2:241063843-241063865 GGGGTGGAGGTGAGGGTGCTGGG + Intronic
1169506120 20:6213307-6213329 GTGGTGGTGGGGGTGGTGGTGGG + Intergenic
1169506125 20:6213319-6213341 GTGGTGGTGGGGGTGGTGGTAGG + Intergenic
1169740564 20:8889182-8889204 GTGGTGGAAGTGATGGTGCATGG - Intronic
1170131138 20:13021559-13021581 GTGGAGGTGGGGATGGTGGCGGG - Intronic
1170329465 20:15192507-15192529 GTGGCAGAGGTGGTGCTGGTAGG - Intronic
1170656072 20:18288715-18288737 GCGGGGGTGGTGATTGTGGTGGG + Intronic
1170783831 20:19450433-19450455 GTGGCAGAGGGGAGGGAGGTTGG + Intronic
1171489323 20:25505316-25505338 GTGGTGGGGGAGATGCTGGTTGG + Intronic
1172194547 20:33083187-33083209 GTGGAGGAGGTGGCAGTGGTGGG + Intronic
1172261391 20:33568948-33568970 AGGGAGGAGGTGATGGGGGTGGG - Intronic
1172287769 20:33753249-33753271 GAGGCTGAGGTGGTGGCGGTGGG - Exonic
1172462872 20:35133304-35133326 GAGGCGCAGGTGATGGCAGTTGG + Intronic
1172679257 20:36699671-36699693 GTGGTGGTGGTGGTGGTGGTAGG + Intronic
1172945545 20:38685483-38685505 GTGATGGTGGTGGTGGTGGTGGG - Intergenic
1173807428 20:45934968-45934990 GTGGCCGAAGTGAGGGAGGTGGG + Intronic
1174161300 20:48552665-48552687 CTGGTGGTGGTGATAGTGGTGGG - Intergenic
1174187788 20:48719407-48719429 GTGGGCGAGGTGTTGGTGCTCGG + Intronic
1174733149 20:52937977-52937999 CTAGTGGTGGTGATGGTGGTGGG - Intergenic
1174755929 20:53158446-53158468 GTGGCTGGGCTGATAGTGGTGGG + Intronic
1175323034 20:58102930-58102952 GTGGTGGTGGTGGTGGTGGGTGG - Intergenic
1175854260 20:62111918-62111940 CTGGGGGAGGTGAGGGTGGGAGG + Intergenic
1175898282 20:62349825-62349847 ATGGTGGGGGTGATGATGGTGGG + Intronic
1176247814 20:64105612-64105634 GGGGTGGGGGTGATGGGGGTGGG + Intergenic
1176247822 20:64105639-64105661 ATGGTGGATGTGATGGGGGTGGG + Intergenic
1176247847 20:64105705-64105727 GTGGGGGTGGTGGTGGGGGTGGG + Intergenic
1176872907 21:14098279-14098301 GTGATGGTGGTGATGGTGATGGG - Intergenic
1177499889 21:21940173-21940195 GTGGTGGTGGTGGTGGTTGTGGG + Intergenic
1177905099 21:26965427-26965449 GTGGTGAAGGTGGTGGTGCTAGG - Exonic
1177998945 21:28136068-28136090 GTGGTAGTGGTGGTGGTGGTGGG + Intergenic
1178340817 21:31784552-31784574 GTGGTGGTGGTGGTGGTTGTTGG - Intergenic
1178340842 21:31784660-31784682 GTGGTGGTGGTGGTGGTGGTTGG - Intergenic
1178341036 21:31785440-31785462 GTGGTGGTGGTGGTGGTAGTTGG - Intergenic
1178341111 21:31785882-31785904 GTGGTGGTGGTGGTGGTAGTGGG - Intergenic
1178478970 21:32962592-32962614 GTGGGGGTGGGGATGGAGGTCGG + Intergenic
1178797208 21:35755955-35755977 GTGGCGGGGGTGTTGGCGGCGGG - Intronic
1179005668 21:37512056-37512078 GTGGTGGTGGTGATGGTGATGGG - Exonic
1179251261 21:39673480-39673502 GTGGGAGAGGAGATGATGGTGGG - Intergenic
1179365121 21:40751913-40751935 GTGGCCGAGGAGATGGGGATGGG - Intronic
1179500636 21:41806451-41806473 GTGCTGGTGGTGATGGTGATGGG - Intronic
1179590218 21:42403218-42403240 GAGGCGGGGGTGGTGGTGGGTGG - Intergenic
1179710949 21:43262650-43262672 GTGGTGATGGTGGTGGTGGTGGG + Intergenic
1179710967 21:43262719-43262741 GTGATGGTGGTGGTGGTGGTGGG + Intergenic
1180469628 22:15642959-15642981 GTGGCGGGGGTGGTGGAGGGAGG + Intergenic
1180843555 22:18970206-18970228 GCGGCGGAGGGGATGGCGGCTGG - Intergenic
1181387553 22:22557312-22557334 GAGGCGGCGGTGCTCGTGGTTGG - Exonic
1181532750 22:23526313-23526335 ATGATGGAGGTGATGGTGGTTGG + Intergenic
1181715610 22:24725221-24725243 GTGGTGGAGGTGGTGGAGGTGGG + Intronic
1181852690 22:25761381-25761403 GTGGTGGTGGTGGTGGTGGGGGG + Intronic
1181920253 22:26315021-26315043 GTGGCAGACGGGAGGGTGGTTGG + Intronic
1182345232 22:29658614-29658636 GTGGGGGTGGGGATGGGGGTGGG - Intronic
1182750100 22:32634693-32634715 GGGGCAGAGGTGATGCTGGAGGG - Intronic
1182800558 22:33028694-33028716 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1183314494 22:37129451-37129473 GAGGCGGAGGGGGTGGGGGTGGG - Intronic
1183697296 22:39430623-39430645 GTGAGGGAGGTGATGGTGGGAGG - Exonic
1183769615 22:39912773-39912795 GTGGCCGGAGTGATGGTGGTGGG + Intronic
1183965103 22:41436807-41436829 GAGGCGGTGGTGAAGGTGATGGG + Exonic
1183990556 22:41594440-41594462 GTGGCGGGGGTGGGGGTGGGGGG + Intergenic
1184291249 22:43499154-43499176 GTGACGGAGGTGATGGTGGGAGG + Intronic
1184291277 22:43499257-43499279 GAGGTGGTGGTGATGGTGATGGG + Intronic
1184291302 22:43499360-43499382 GAGGTGGTGGTGATGGTGATGGG + Intronic
1184291319 22:43499426-43499448 ATGTGGGAGGTGGTGGTGGTGGG + Intronic
1184291347 22:43499529-43499551 GAGGTGGTGGTGATGGTGGGTGG + Intronic
1184666888 22:45994003-45994025 ATGGAGGTGGTGATGGAGGTGGG + Intergenic
1184852417 22:47128216-47128238 GGGGCGGAGGGGATGGTTGGGGG - Intronic
1185012232 22:48320765-48320787 CTGGCGGAGGAGATGGTGTCAGG - Intergenic
1185151336 22:49165273-49165295 GTGGCGGTGGGGATGGGAGTAGG - Intergenic
1185215446 22:49597407-49597429 GTGATGGTGGTGATGGTAGTGGG + Intronic
1185215453 22:49597437-49597459 GTGATGGTGGTGATGGTAGTGGG + Intronic
1185332087 22:50256464-50256486 GTGGCTGAGGAGCTGGTGGGTGG - Intronic
949775693 3:7630189-7630211 CTGGGGATGGTGATGGTGGTGGG + Intronic
950339382 3:12229250-12229272 GTGGCGGTGATGGTGGTGGTGGG - Intergenic
950344375 3:12279130-12279152 GAGGCGGAGGTTATGGTGAGCGG - Intergenic
950402147 3:12777280-12777302 GTGGTTGTGGTGGTGGTGGTGGG + Intergenic
950853310 3:16083117-16083139 GTGGTGGTGGTGATGGTAGGTGG + Intergenic
950853329 3:16083229-16083251 GTGGCGGAAGTGTTGGCGGTAGG + Intergenic
951109159 3:18781256-18781278 ATGGTGGTGGTGATGGTAGTTGG + Intergenic
951154821 3:19338392-19338414 GTGGTAGTGGTGGTGGTGGTAGG - Intronic
952043232 3:29285237-29285259 GTGGGGGTGGGGGTGGTGGTGGG + Intronic
952396151 3:32922373-32922395 GTGGTGGAGGTGGTGGAGGTTGG + Intergenic
953182195 3:40606213-40606235 GTAGTGGTGGTAATGGTGGTTGG - Intergenic
953317442 3:41942034-41942056 GTGGTTGAGGTGAAGGTGGAGGG - Intronic
953390777 3:42532484-42532506 CTGGAGCAGGGGATGGTGGTGGG - Intronic
953392323 3:42540772-42540794 GAGGCCGAGGGGATGATGGTGGG + Intergenic
953464467 3:43106614-43106636 GAGGTGGAGTTGGTGGTGGTAGG - Intergenic
954333238 3:49901923-49901945 GTGGTGGTGGTGGTGGTGGCGGG + Intronic
954395693 3:50292203-50292225 GTGGAGGAGGTGAGTGGGGTGGG - Exonic
954407687 3:50354604-50354626 GTGGTGGTGGTGGCGGTGGTGGG + Intronic
954418615 3:50406633-50406655 ATGGTGGAGCTGATGGTGATGGG - Intronic
954981486 3:54749941-54749963 GTGGTGGTGGTGGTCGTGGTAGG + Intronic
955085439 3:55697986-55698008 GTGGTGGTGGTGATGGTGAAGGG + Intronic
955198724 3:56830244-56830266 ATGGTGGAGGTGGTGCTGGTGGG + Intronic
955203787 3:56876788-56876810 GTGGCGATGGAGCTGGTGGTGGG - Intronic
955330263 3:58041523-58041545 CTGGTGGTGGTGGTGGTGGTTGG - Intronic
955492439 3:59496820-59496842 GTGGTGGCGGGGATGGGGGTGGG - Intergenic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
956500578 3:69879336-69879358 GTGGCAGAGGGAAGGGTGGTGGG - Exonic
956544956 3:70390688-70390710 ATGGTGGAGGTGATGGAGGTGGG - Intergenic
956787051 3:72651569-72651591 GTAGTGGAGATGATGGTAGTAGG - Intergenic
956891650 3:73620072-73620094 GTGGTAGTGGTGATGGGGGTGGG - Intronic
957068898 3:75550069-75550091 GTTGTGGTGGTGGTGGTGGTGGG - Intergenic
957236727 3:77602646-77602668 GTGGTGGCGGTGGTGGTGGTAGG - Intronic
958733992 3:97988931-97988953 GTGGGGATGGTGGTGGTGGTAGG + Intronic
958882823 3:99692144-99692166 GTGGTGGTGGTGGTTGTGGTTGG - Intronic
959252077 3:103961647-103961669 GTGGCGGAGGTGGGCGGGGTGGG + Intergenic
959256828 3:104025776-104025798 GTGGCGGGGGCGCGGGTGGTGGG + Intergenic
959455950 3:106561894-106561916 TTGCTGGAGGTGGTGGTGGTAGG + Intergenic
960915553 3:122690855-122690877 TTGGCAGCTGTGATGGTGGTGGG + Intronic
961427895 3:126861991-126862013 GGGGAGGTGGTGATGGTGGAGGG - Intronic
961428005 3:126862348-126862370 GTGGAGGAGGTGGTGATAGTGGG - Intronic
961428487 3:126864070-126864092 GTGGAGGAGGTGGTGATTGTGGG - Intronic
961512044 3:127409198-127409220 GTGGTGGAGGTGACAGGGGTAGG - Intergenic
961534845 3:127564040-127564062 GTAGTGGTAGTGATGGTGGTGGG - Intergenic
961652645 3:128424839-128424861 GTGGGGGAGGAGATTGGGGTGGG - Intergenic
961656592 3:128445786-128445808 GTGGTGGTGATGATGGTGGTGGG + Intergenic
961836205 3:129662170-129662192 GGGGCAGAGGAGATGGTGGGTGG + Intronic
963734217 3:149001772-149001794 GTGGGGTGGGTGGTGGTGGTGGG + Intronic
963981246 3:151539651-151539673 GTGTTGGAGGTGGGGGTGGTCGG - Intergenic
964311723 3:155400878-155400900 GAGGTGGAGGTGATGGTTGTGGG - Intronic
964319438 3:155479555-155479577 GTGGTGGTGGTGGTGGTCGTGGG - Intronic
966126277 3:176580466-176580488 GAGGTGGAGGTGATGGAGGGTGG + Intergenic
966863736 3:184244792-184244814 GTTGCTGTGGTGATGGTGGGGGG - Intronic
966872358 3:184299255-184299277 GTGGCGGCGGAGATGGAGGAGGG + Exonic
966875971 3:184321884-184321906 GTAGCAGAGGGGATGGTGGGGGG - Exonic
967117609 3:186355733-186355755 GTGGTGGTGATGCTGGTGGTAGG - Intronic
967158831 3:186717866-186717888 GTGGTTGTGGTGGTGGTGGTGGG - Intronic
967518988 3:190405595-190405617 TTGGTGGAGTTGGTGGTGGTGGG - Intronic
967772851 3:193353864-193353886 TTGGTGGTGGTGGTGGTGGTGGG - Intronic
967870292 3:194224019-194224041 GTGGAGGGGGTGGTGGTGGCAGG - Intergenic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
968312176 3:197693181-197693203 TTGGTGGTGGTGGTGGTGGTAGG - Intronic
968522354 4:1039690-1039712 GTGGCGGTGGTGGTGGGGGCGGG + Intergenic
969104314 4:4793576-4793598 GTGACGGTGCTGATGGTGGTAGG + Intergenic
969234602 4:5856857-5856879 GTGGTGATGGTGATGATGGTGGG - Intronic
969336130 4:6511579-6511601 GTGGTGGTGGTGGTGGTGATGGG + Intronic
969336264 4:6512098-6512120 GTGGTGGTGGTGGTGATGGTGGG + Intronic
969347650 4:6579385-6579407 GTGGTGGTGGTGATGGTGAAGGG - Intronic
969418558 4:7076593-7076615 GTGGCCATGGTGACGGTGGTGGG + Intergenic
969472956 4:7400461-7400483 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
969529793 4:7724307-7724329 GTGGTGGTGGTGGTGGTGATAGG + Intronic
969710903 4:8842818-8842840 GTGGTAGAGATGATGGTGGTGGG + Intergenic
970027341 4:11637338-11637360 GTGGGGAAGGTGCTGGTGGAAGG - Intergenic
971244199 4:24913306-24913328 GTGGGAGTCGTGATGGTGGTCGG - Intronic
972375415 4:38465197-38465219 GAGGAGGAGGTGGTGGTGGTTGG - Intergenic
972905960 4:43747375-43747397 ATGGTGGTGGTGGTGGTGGTGGG + Intergenic
972960149 4:44444780-44444802 GTGGTGGGGGTGACGGGGGTTGG + Intronic
973531896 4:51843485-51843507 AGGGCGGAGGTGAGGGGGGTGGG + Intronic
973807201 4:54537998-54538020 GTTGGGGATGTGATGGTAGTGGG - Intergenic
973892529 4:55381734-55381756 GTTGCAGTGGTGATGGTGGCGGG + Intergenic
975170564 4:71227658-71227680 GTTGAAGAGCTGATGGTGGTGGG + Intronic
975863096 4:78698786-78698808 GTGCTGGTGGTGGTGGTGGTGGG + Intergenic
976070367 4:81233348-81233370 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
977275981 4:94977784-94977806 GTGGCGGAGGTTGTGGTGAGCGG + Intronic
977809805 4:101346448-101346470 GCGGCGGGGGTGGCGGTGGTGGG - Intronic
977959139 4:103065075-103065097 GTGGGGGAGGTGAAAGTGGCAGG + Intronic
978402901 4:108349717-108349739 GAGGCTGAGGTGAGGGAGGTGGG + Intergenic
979195656 4:117917173-117917195 GTAGCGGTGGTGGTGGCGGTGGG - Intergenic
979556456 4:122052973-122052995 GTGGAGGAGGTGAAGGTGAATGG + Intergenic
981006386 4:139879605-139879627 GTCGTGGTGGTGATAGTGGTTGG + Intronic
981018035 4:139994762-139994784 GTGGTGGTGGTGGTGCTGGTGGG + Intronic
981018038 4:139994765-139994787 GTGGTGGTGGTGCTGGTGGGGGG + Intronic
981034139 4:140152802-140152824 TTGGGGGTGGTGGTGGTGGTGGG - Intronic
981552863 4:145959437-145959459 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
981552864 4:145959440-145959462 GTGGTGGTGGTGGTGGTGGGTGG + Intergenic
981760118 4:148185061-148185083 GTGGCGGAGGTGGTGAATGTGGG - Intronic
981997866 4:150994187-150994209 GTGGTGGTGGTGATGGTGGTGGG - Intronic
982207308 4:153006297-153006319 GTGGAGGAGGAGAGGGTGGGTGG + Intergenic
982221566 4:153129600-153129622 GTGATGGTGGTGGTGGTGGTGGG - Intergenic
982221595 4:153129710-153129732 GTGATGGTGTTGATGGTGGTGGG - Intergenic
982320936 4:154077046-154077068 GTGACGGTGGTGGTGGTGGTGGG - Intergenic
982761190 4:159286028-159286050 GTGGTGGTGGTGGTGGTGGTTGG - Intronic
983090887 4:163500555-163500577 GTTGGGGTGGTCATGGTGGTTGG + Intronic
983891479 4:173034492-173034514 TTGTCAGAGGTGATGGAGGTTGG - Intronic
983985435 4:174053825-174053847 GAGGCGGAGGTTATGGTGAGTGG + Intergenic
984578542 4:181481265-181481287 GAGGAGGAGGAGATGGTAGTGGG - Intergenic
984942561 4:184946568-184946590 GTTGTGGTGGTGGTGGTGGTTGG + Intergenic
985364251 4:189210341-189210363 GTGGTAGTGGTGATGGTGGTGGG + Intergenic
985451969 4:190067610-190067632 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985452956 4:190070901-190070923 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985452977 4:190070944-190070966 GTGGTGGTGGTGGTGGTGGGGGG - Intergenic
985452980 4:190070947-190070969 GGGGTGGTGGTGGTGGTGGTGGG - Intergenic
985453945 4:190074194-190074216 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985453966 4:190074237-190074259 GTGGTGGTGGTGGTGGTGGGGGG - Intergenic
985453969 4:190074240-190074262 GGGGTGGTGGTGGTGGTGGTGGG - Intergenic
985454933 4:190077487-190077509 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985454954 4:190077530-190077552 GTGGTGGTGGTGGTGGTGGGGGG - Intergenic
985454957 4:190077533-190077555 GGGGTGGTGGTGGTGGTGGTGGG - Intergenic
985455919 4:190080784-190080806 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985455942 4:190080827-190080849 GTGGTGGTGGTGGTGGTGGGGGG - Intergenic
985455945 4:190080830-190080852 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
985456904 4:190084078-190084100 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985456925 4:190084121-190084143 GTGGTGGTGGTGGTGGTGGGGGG - Intergenic
985456928 4:190084124-190084146 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
985457892 4:190087374-190087396 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985457913 4:190087417-190087439 GTGGTGGTGGTGGTGGTGGGGGG - Intergenic
985457916 4:190087420-190087442 GGGGTGGTGGTGGTGGTGGTGGG - Intergenic
985458880 4:190090671-190090693 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985458901 4:190090714-190090736 GTGGTGGTGGTGGTGGTGGGGGG - Intergenic
985458904 4:190090717-190090739 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
985463132 4:190173434-190173456 GTGGTGGCGGTGGTGGTGGTGGG - Intergenic
985463152 4:190173476-190173498 GTGGTGGTGGTGGTGGTGGGGGG - Intergenic
985463155 4:190173479-190173501 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
985674179 5:1221749-1221771 GTGGTGGTGGTGATTGTGGCTGG + Exonic
986097528 5:4574450-4574472 GTGGTGGTGGTCATGGTAGTGGG - Intergenic
986097536 5:4574480-4574502 GTGGTAGTGGTCATGGTGGTGGG - Intergenic
986300899 5:6477463-6477485 GTGGTGGGGGTGGTGGTTGTAGG - Intronic
986470282 5:8066939-8066961 TTGGAGAAGGTGCTGGTGGTGGG + Intergenic
987873585 5:23650511-23650533 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
988558785 5:32261523-32261545 GTGCTGGAGGTGATGGTGGGAGG - Intronic
988696383 5:33626383-33626405 ATGGTAGTGGTGATGGTGGTGGG + Intronic
988714534 5:33811853-33811875 GTGGAGGAGGAGAGAGTGGTTGG + Intronic
988809144 5:34767594-34767616 GTGGGGGTGGTGGGGGTGGTGGG - Intronic
990349064 5:54897746-54897768 GTGGAGGAGGGGATGGAGGAGGG - Intergenic
990410475 5:55535719-55535741 GTGAGGGAGGTGACGGTGGATGG - Intergenic
990789886 5:59465293-59465315 GTGTAGGTGGTGATGGTGGTAGG - Intronic
991774245 5:70069255-70069277 GTGGTGGCGGTGGCGGTGGTGGG - Exonic
991853540 5:70944678-70944700 GTGGTGGCGGTGGCGGTGGTGGG - Exonic
992062953 5:73074900-73074922 GTGGAGGAGGTGGTGGGGCTTGG + Intronic
992344688 5:75864956-75864978 GTGTTGGAGGTGTTGGTGGTGGG + Intergenic
992484429 5:77181092-77181114 GTGAGGGTGGGGATGGTGGTGGG - Intergenic
992698461 5:79314652-79314674 CAGGCAGAGGTGGTGGTGGTGGG - Exonic
992791846 5:80220808-80220830 GTGGTGGGAGTGGTGGTGGTAGG + Intronic
993892513 5:93490920-93490942 GTGGTGGTGATGGTGGTGGTGGG + Intergenic
993892603 5:93491352-93491374 GTGGTAGTGGTGATGGTGGGGGG + Intergenic
995568421 5:113455375-113455397 GTGGTGGTGGTGATGGTGGGGGG - Intronic
995784409 5:115813903-115813925 GTGGTGGCAGTGGTGGTGGTTGG - Intronic
995819917 5:116218297-116218319 GTGGTGGCAGTGATGGTGGTGGG + Intronic
996230800 5:121061180-121061202 GTGGTAGTGGTGGTGGTGGTAGG - Intergenic
996774373 5:127118230-127118252 GAGTTGGAGGTGTTGGTGGTAGG + Intergenic
997439680 5:133900412-133900434 GTGGTGGTGGTGGTAGTGGTGGG - Intergenic
997802971 5:136885430-136885452 CTGGTGGTGGTGGTGGTGGTGGG - Intergenic
997940427 5:138152494-138152516 GTGGAGGAGGTTCTGGTGGCTGG + Exonic
998378911 5:141710102-141710124 GAGGAGGAGGTGGGGGTGGTAGG + Intergenic
998655285 5:144171571-144171593 GTGGTGATGGTGGTGGTGGTTGG - Intronic
999120155 5:149203293-149203315 GTGATGGAGGTAGTGGTGGTGGG - Intronic
999361897 5:150992552-150992574 GAGGAGGAGGGGATGGTGGTGGG + Intergenic
999599744 5:153249061-153249083 GTGGTGGTGGTGGTGGTGGTAGG + Intergenic
999725028 5:154430019-154430041 GTGGTGGTGGTGGTGGTGGTTGG + Intergenic
1000243934 5:159433440-159433462 GGGGTGGAGGTGATGTTGTTTGG + Intergenic
1001715457 5:173811482-173811504 GTGAAGGTGGTGATAGTGGTTGG + Intergenic
1001733066 5:173974208-173974230 GTGGTGGTGGTGGTGGTGGTAGG + Intronic
1001773520 5:174312422-174312444 GTGGGGGCGCTGATTGTGGTGGG + Intergenic
1001885586 5:175287477-175287499 TTGGAGGAGGTGTTGGAGGTTGG - Intergenic
1002158776 5:177303037-177303059 GTGGCCAAGGTGATGTCGGTCGG - Exonic
1002273639 5:178089359-178089381 GTGAGAGAGGTGAGGGTGGTGGG - Intergenic
1002371177 5:178756059-178756081 GTGGGGGTGGTGGTGATGGTGGG + Intergenic
1002371193 5:178756106-178756128 GTGACGGTGGTGGTGGTGGCGGG + Intergenic
1002587057 5:180255681-180255703 CTGGTGGATGTGATGGTGTTTGG - Intronic
1002690346 5:181045912-181045934 GTGGAGGAGGTGTTGGGGGCTGG - Intronic
1002690357 5:181045942-181045964 GTGGAGGAGGTGTTGGAGGCTGG - Intronic
1002690366 5:181045972-181045994 GTGGAGGAGGTGTTGGAGGCTGG - Intronic
1002690375 5:181046002-181046024 GTGGAGGAGGTGTTGGGGGCTGG - Intronic
1002690393 5:181046061-181046083 GTGGAGGAGGTGTTGGGGGCTGG - Intronic
1002690404 5:181046091-181046113 GTGGAGGAGGTGTTGGGGGCTGG - Intronic
1002690415 5:181046121-181046143 GTGGAGGAGGTGTTGGGGGCTGG - Intronic
1002690426 5:181046151-181046173 GTGGAGGAGGTGTTGGAGGCTGG - Intronic
1002690435 5:181046181-181046203 GTGGAGGAGGTGTTGGGGGCTGG - Intronic
1002690446 5:181046211-181046233 GTGGAGGAGGTGTTGGGGGCTGG - Intronic
1002690462 5:181046270-181046292 GTGGAGGAGGTGTTGGGGGCTGG - Intronic
1003003065 6:2354875-2354897 GTGGTGGAGGTGGTAGTGGAGGG + Intergenic
1003202029 6:3970042-3970064 CTGGTGGTGGTGGTGGTGGTGGG + Intergenic
1003450490 6:6226915-6226937 GTGGTGGTGGTGATGCTGGGGGG + Intronic
1003465551 6:6376814-6376836 GTGGTGGTGGTGGTGGTGGAGGG - Intergenic
1004548439 6:16622366-16622388 ATGGTGGTGGTGGTGGTGGTTGG + Intronic
1005400133 6:25423536-25423558 GTGGAGGAGGCGGTGGTGGGAGG + Intronic
1005833373 6:29688858-29688880 GTGGTGGTGGTGTTGGAGGTGGG - Intergenic
1005919135 6:30382960-30382982 GGGGCAGGGGTGGTGGTGGTGGG + Intergenic
1006155360 6:32010443-32010465 GTGGTGAAGGTGATGCTGGCTGG + Intergenic
1006161666 6:32043177-32043199 GTGGTGAAGGTGATGCTGGCTGG + Exonic
1006180473 6:32150788-32150810 GTGGTGGTGGTGATGGTGTGAGG + Exonic
1006448173 6:34091438-34091460 GTGGTGGGGGTGAGGGTGGAGGG - Intronic
1007182706 6:39941904-39941926 GTGGCAGAAGTGATGGTGTTAGG + Intergenic
1007512762 6:42386966-42386988 GTGATGGTGGTGATGATGGTAGG - Intronic
1007641013 6:43339635-43339657 GTGGTGGAGGTGGTGGAGGTGGG + Exonic
1007960228 6:45952123-45952145 GTGGTGATGGTGGTGGTGGTGGG + Intronic
1008096797 6:47347181-47347203 CTGGAGGAGGTGATGGTGCTGGG + Intergenic
1008147764 6:47912266-47912288 GTGGGGGATGGGATGGGGGTGGG - Intronic
1008687146 6:53938242-53938264 GTGGAGGAGGTAAAGGTAGTAGG - Intronic
1011278159 6:85649992-85650014 GTGGAGGAGGTGTTGGTGAGAGG + Intergenic
1011507797 6:88067613-88067635 GTGGCAGGGGTGATGGGGGATGG + Intergenic
1012313708 6:97759258-97759280 GTGGTAGAGGTGGTGGGGGTGGG + Intergenic
1012381942 6:98630672-98630694 GTGGCGGGGGGGATGGGGGGTGG + Intergenic
1012555338 6:100504935-100504957 GTGGAGGCAGTGGTGGTGGTGGG + Intergenic
1012910668 6:105113923-105113945 GTGGCGGGGGGGATGGGAGTTGG - Intronic
1013075419 6:106766540-106766562 TTGGTGGTGGTGATGGGGGTGGG - Intergenic
1013371976 6:109478628-109478650 GAGGCGGAGGTTGTGGTGATCGG + Intronic
1014007878 6:116442220-116442242 GTGGGGGAGGGGAGGGTGATAGG + Intergenic
1014479468 6:121917846-121917868 GTGGTAGGGGTGATGGTGGTGGG + Intergenic
1014799223 6:125759309-125759331 GTGGAGCGGATGATGGTGGTGGG - Exonic
1016110505 6:140218316-140218338 GTTTTGGTGGTGATGGTGGTGGG + Intergenic
1016827774 6:148404575-148404597 GTGGGGCAGGTGGTGGGGGTTGG - Intronic
1017071889 6:150582596-150582618 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1017429215 6:154354394-154354416 GTGGTGGTGGAGATGGTGGTTGG - Intronic
1017672102 6:156778168-156778190 GTGGTGGTGGTGCTGCTGGTGGG - Exonic
1017672117 6:156778219-156778241 GTGGTGGTGGTGGAGGTGGTGGG - Exonic
1017720205 6:157238484-157238506 GTGGCAGTGATGGTGGTGGTGGG + Intergenic
1018132872 6:160749308-160749330 GTGGTGGTGATGATGTTGGTGGG - Intronic
1018132949 6:160749794-160749816 ATGGTGACGGTGATGGTGGTGGG - Intronic
1018699524 6:166415807-166415829 GTGGCAGAGGTGATGGCAGCTGG - Intronic
1018699585 6:166416084-166416106 ATGGTGGAGGTGATGGAGGAAGG - Intronic
1018699639 6:166416318-166416340 ATGGCAGAGATGATGGTGGAGGG - Intronic
1019268596 7:133439-133461 GTGTCAGAGGTGGTGGGGGTGGG - Intergenic
1019328392 7:450855-450877 GTGGCAGAGCTGATGGTGACAGG + Intergenic
1019332490 7:467305-467327 TGGGAGGAGGTGATGGTTGTGGG - Intergenic
1019332530 7:467486-467508 TGGGAGGAGGTGATGGTTGTGGG - Intergenic
1019390493 7:784021-784043 GTGGGGGAGGTGGGGGAGGTGGG - Intronic
1019820021 7:3235499-3235521 GTGGTGGAGATGATGGTGGTAGG + Intergenic
1020085634 7:5308845-5308867 GTGGTGGTGGTGGTGGTGGGCGG - Intronic
1020085635 7:5308848-5308870 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
1020175179 7:5876472-5876494 CTGGGCGAGGTGATGCTGGTTGG + Intergenic
1021352761 7:19615680-19615702 GTGGCAGAGGTGAAAGAGGTTGG + Intergenic
1022088981 7:27095700-27095722 GTGGTGGTGGTGGTGGTGGTGGG + Exonic
1022098354 7:27154733-27154755 CTGGAGTAGGTGATGGGGGTGGG + Exonic
1022535662 7:31096666-31096688 GTTGCGGAGGAGGTGGTGGTGGG + Intronic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1022900701 7:34807890-34807912 GTGGTGGTGGTGGTGGTGGGGGG - Intronic
1024284355 7:47744422-47744444 GGGGTGGAGGTGGAGGTGGTGGG + Intronic
1024557616 7:50616931-50616953 GTTGGGGAGGTGATGCTGGCAGG + Intronic
1024569705 7:50713644-50713666 GTGGAGGAGGTGGAGGTGATGGG - Intronic
1024634410 7:51275593-51275615 GTGGCGGTGGTGGTGGTGGCAGG - Intronic
1024644882 7:51362708-51362730 GTGGTGGTGGTGGTGATGGTGGG - Intergenic
1024735806 7:52303038-52303060 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
1024735807 7:52303041-52303063 GTGGTGGTGGTGGTGGTGGGAGG + Intergenic
1026292520 7:69020536-69020558 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
1026659382 7:72286267-72286289 GTGGTGGAAGAGATGGTGGTGGG - Intronic
1026858342 7:73769345-73769367 TTGGTGGTGGTGGTGGTGGTGGG + Exonic
1029071877 7:97906243-97906265 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1029196800 7:98811039-98811061 GTGGTGGAGGTGGTGGTGGTTGG + Intergenic
1029196810 7:98811076-98811098 GTGGCGGTGGTGGTGGTTGTTGG + Intergenic
1029196820 7:98811116-98811138 GTGGTGGTGGTGGTGGTGGTTGG + Intergenic
1029196840 7:98811214-98811236 GTGGTGGTGGTGGTAGTGGTTGG + Intergenic
1029196878 7:98811369-98811391 GTGGTGGTAGTGGTGGTGGTTGG + Intergenic
1029196902 7:98811483-98811505 GTGGTGGTGGTGGTAGTGGTTGG + Intergenic
1029196909 7:98811514-98811536 ATGGTGGTGGTGATGGTAGTGGG + Intergenic
1029196932 7:98811591-98811613 GTGGTGGTGGTGGTGGTGGTTGG + Intergenic
1029339881 7:99934138-99934160 GTGGTGGTGGTGGTGGTGGTAGG - Intergenic
1029413521 7:100429765-100429787 GTGGCGGAGGAGAAAGGGGTCGG + Exonic
1029638931 7:101805989-101806011 TTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1029710292 7:102295486-102295508 GTGGTGGTGGTGGTGGTGGCAGG + Intronic
1029796142 7:102896385-102896407 GTGGCTGTGGAGATGGTGGTTGG + Intronic
1030005359 7:105112901-105112923 GTGGCGGCGGAGGGGGTGGTGGG - Exonic
1030682266 7:112446558-112446580 AGGGTGGAGGTGCTGGTGGTAGG + Intronic
1031122602 7:117738673-117738695 GGGGAGGAGGTGGTGGTGATGGG + Intronic
1031454027 7:121957318-121957340 ATGGTGGCGGCGATGGTGGTGGG + Intronic
1031598357 7:123673273-123673295 GTAGTGGTGGTGATGGAGGTGGG + Intergenic
1032455537 7:132070674-132070696 GTGGCGGAGGGGAGGGTGGGCGG - Intergenic
1032504713 7:132426277-132426299 GCGGCTAAGGTGATGGGGGTGGG + Intronic
1032956166 7:136973765-136973787 GTAATGGAGTTGATGGTGGTGGG + Intronic
1033098584 7:138451534-138451556 GTGGTGGTGTTGGTGGTGGTGGG + Intergenic
1033327349 7:140390630-140390652 CTGGCGGTGGGGATGGAGGTTGG - Intronic
1033328613 7:140399264-140399286 GCGGCGGTGGTGGTGGTGGATGG - Intronic
1033510704 7:142057513-142057535 GTGATGGTGGGGATGGTGGTTGG + Intronic
1033513487 7:142083689-142083711 GTGATGGTGATGATGGTGGTAGG + Intronic
1033773490 7:144580517-144580539 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
1035035470 7:155891517-155891539 GCAGTGGAGGTGATGGAGGTGGG + Intergenic
1035342434 7:158172515-158172537 ATGGTGGAAGTGATGATGGTGGG - Intronic
1035342499 7:158172924-158172946 ATGGTGGAAGTGATGATGGTGGG - Intronic
1035342696 7:158174326-158174348 ATGGTGAAGATGATGGTGGTGGG - Intronic
1035380950 7:158440679-158440701 GTGGTGGTGGTGATGGTGATAGG + Intronic
1035381005 7:158440935-158440957 GTGGTGGTGATGATGGTGATGGG + Intronic
1035783174 8:2244467-2244489 GAGGGGGTGGTGATGGGGGTGGG + Intergenic
1035808951 8:2475119-2475141 GAGGGGGTGGTGATGGGGGTGGG - Intergenic
1036254973 8:7198712-7198734 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1036362514 8:8088795-8088817 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
1036487008 8:9188477-9188499 GTGGCGGAAGTGGGGGTGGGGGG + Intergenic
1036561745 8:9904666-9904688 GTGGAGGAGGGCATGGGGGTGGG - Intergenic
1036573877 8:10006502-10006524 GGGGCGGAGGTGCTGGGGCTGGG + Intergenic
1036896045 8:12636376-12636398 GTGGTGGTGGGGGTGGTGGTGGG - Intergenic
1037445103 8:18957298-18957320 GAGGCGGAGGTTATGGTGAGCGG + Intronic
1037609555 8:20464652-20464674 GTCTAGGAGGTGATGGGGGTAGG + Intergenic
1037783748 8:21889418-21889440 GTGGGGGAGGTGGTGGTGTGTGG + Intergenic
1037956590 8:23065034-23065056 GTGGGGGAGGTGACAGTGGTGGG + Intronic
1038149600 8:24930497-24930519 GGTGGGGAGGTGATGGTGGCAGG + Intergenic
1038960192 8:32509834-32509856 GTACTGGAGGTGGTGGTGGTGGG + Intronic
1039071765 8:33655408-33655430 GTGGTGGAGGGAATGGGGGTAGG - Intergenic
1040428013 8:47308634-47308656 GTGGGGGTGGGGATGGGGGTGGG + Intronic
1040859697 8:51986262-51986284 TTGGCGGTGGGGATGGGGGTTGG + Intergenic
1042060922 8:64816893-64816915 GTGATGGAGGTGGTGGTGATGGG - Intergenic
1042119713 8:65473400-65473422 GTTGTGGTGGTGATGGGGGTGGG - Intergenic
1042480377 8:69295906-69295928 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1042566688 8:70118477-70118499 GTGGCAGAGGTGCTGGCTGTTGG - Intronic
1042651837 8:71051506-71051528 CTGGTGGCGGTGGTGGTGGTGGG + Intergenic
1042710623 8:71713130-71713152 GTGGTGGTGGTGATGGTAGCAGG + Intergenic
1043161509 8:76853050-76853072 GAGGAGGAGGTGGTGGTGGTGGG - Exonic
1043313748 8:78894795-78894817 GTGTTGGGGGTGCTGGTGGTGGG - Intergenic
1043984120 8:86673447-86673469 GTGGCAGGAGTGATGGTGGTTGG + Intronic
1043986485 8:86698680-86698702 GTGAGGTAGGTGGTGGTGGTTGG + Intronic
1044730483 8:95224936-95224958 GTGGGGGATGTGGTGGTGGGGGG + Intergenic
1044826523 8:96203545-96203567 GTGGCTGATGTGATGATGCTTGG - Intergenic
1045042977 8:98244450-98244472 GTGGGCGTGGTGATGGGGGTAGG + Intronic
1045082806 8:98647042-98647064 GTAAGGGAGGTGATGGAGGTAGG - Intronic
1045378698 8:101601190-101601212 GTGGTGGTGGTGGTGGTGGTGGG - Intronic
1045854836 8:106752793-106752815 GTGGTGGTGGTCATGGTGTTAGG + Intergenic
1045957753 8:107928874-107928896 GTGGTGGTGGTGATGGTAGTTGG + Intronic
1045988858 8:108282586-108282608 GTGGCGCAAGTAATGGTGCTAGG + Intronic
1046801430 8:118432830-118432852 GGGGTGGTGGTGATGGTGTTTGG - Intronic
1046810066 8:118523852-118523874 GTGGTAGAGTTGATGGTGGGAGG - Intronic
1047270378 8:123352094-123352116 GTGGCGGGGGTGGTGGTGATGGG + Intronic
1047862581 8:128984636-128984658 GTGGTGGTGGTGGTGGTGGGAGG - Intergenic
1047862582 8:128984639-128984661 GTGGTGGTGGTGGTGGTGGTGGG - Intergenic
1048265038 8:132978369-132978391 GTGTTGGAGGTGATCCTGGTGGG - Intronic
1048457350 8:134590441-134590463 GTGGTAGTGGTGGTGGTGGTGGG - Intronic
1048468241 8:134685155-134685177 GTGACGGTGGTGGTGGTGATGGG - Intronic
1048997653 8:139804328-139804350 GTGGCGGTGGTGGTGGTGCTTGG - Intronic
1048997759 8:139804723-139804745 GTGGTGGTGGTGGTGGTGCTTGG - Intronic
1049193469 8:141302349-141302371 GTGGTGGTGGTGATGGTGAGTGG - Intronic
1049227090 8:141459691-141459713 GTGGTGGAGGTGATTTTGGTTGG + Intergenic
1049388133 8:142354587-142354609 GGGGAGGAGGGGATGGTAGTGGG - Intronic
1049417516 8:142502035-142502057 GTGGTGGTGGTGATGGTGGTCGG + Intronic
1049417620 8:142502548-142502570 GTGGTGGTGGTGGTGGTGATAGG + Intronic
1049538986 8:143197902-143197924 ATTGCCGAGGTGATGGTGTTAGG - Intergenic
1049585201 8:143429792-143429814 GTGGTGGTGGTGGTGGTGGTGGG + Exonic
1049585202 8:143429795-143429817 GTGGTGGTGGTGGTGGTGGGCGG + Exonic
1049695395 8:143981975-143981997 ATGGTGGTGGTGATGGTGATGGG + Intronic
1049697265 8:143990359-143990381 GTGGCGGCGGTGGTGGGGGCGGG + Intronic
1049924954 9:399988-400010 GTGGAGGTGGTGGAGGTGGTGGG - Intronic
1050230951 9:3525780-3525802 GTGATGGAGATGGTGGTGGTGGG + Exonic
1050360857 9:4829705-4829727 GTGGCGGTGGTGGTGGTTGTTGG + Intronic
1050749960 9:8925557-8925579 TTGGCGGGGGTGGTGGGGGTGGG - Intronic
1051079575 9:13279266-13279288 GTGGGGGCGGGGATGGGGGTGGG - Intronic
1051238390 9:15025699-15025721 GTGGAGGTGGTGAAAGTGGTTGG - Intergenic
1051620944 9:19049132-19049154 GTTGCGGTGGTGGTGGCGGTTGG + Intronic
1051862146 9:21638328-21638350 TTTGCGGAGGTGAAGGTGGAGGG - Intergenic
1051918222 9:22232782-22232804 GTGGTGGTGGTGCTGGTGGTAGG - Intergenic
1052735916 9:32342431-32342453 ATGGTGGTGGTGGTGGTGGTGGG - Intergenic
1052821158 9:33138809-33138831 CTGTAGGTGGTGATGGTGGTGGG - Intronic
1053009221 9:34623882-34623904 GCGGCCGAGGTGATGGTGGTGGG + Exonic
1053173434 9:35906604-35906626 GTGGCGGGGATGGTGGCGGTGGG - Exonic
1054946904 9:70805224-70805246 GTGGGGGAGGTGGTGGTGGGGGG + Intronic
1055514136 9:77020067-77020089 GTGGGGGTGGTGGTGGTGATGGG - Exonic
1055609733 9:78009306-78009328 GTGGTGGTGGTGGTGGTGGCAGG - Intronic
1056050327 9:82762077-82762099 GCTGGGGAGGTGATGGTGGGAGG - Intergenic
1056259426 9:84833098-84833120 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1056259427 9:84833101-84833123 GTGGTGGTGGTGGTGGTGGGTGG + Intronic
1056387785 9:86113293-86113315 GTGGTGGTGGCGGTGGTGGTTGG - Intergenic
1056719374 9:89059456-89059478 GTGGGGGAGGACATGGTGGGGGG + Intronic
1056719414 9:89059633-89059655 GTGGAGGACGTGATGGAGGATGG + Intronic
1057739761 9:97701160-97701182 AAGGAGGAGGGGATGGTGGTGGG - Intergenic
1057820084 9:98323526-98323548 GTGGGGGAGAGGGTGGTGGTTGG + Intronic
1058071924 9:100610061-100610083 GTGGCGGTGGTGTTGGTGGTAGG + Intergenic
1058617653 9:106850519-106850541 GTGGCGGGGGACAGGGTGGTGGG + Intergenic
1059522519 9:114956933-114956955 GTGGGAGAGGTGGTGATGGTAGG + Intergenic
1059718556 9:116936281-116936303 TTGGTGGTGGTGATGGTGGGTGG - Intronic
1060260013 9:122066224-122066246 GTGGTGGTGGTGGTGGTGGTAGG + Intronic
1060349252 9:122843305-122843327 GTGGTGGTGGTCATGGTGATCGG - Intergenic
1060404238 9:123365390-123365412 GTGGCGGAGGTGAGTCGGGTGGG - Intronic
1060405619 9:123371587-123371609 CTGGTGGCGGTGGTGGTGGTGGG + Intronic
1060524818 9:124314476-124314498 GTGGTGGTGGTGGTGGTGGTGGG + Intronic
1060589023 9:124804249-124804271 GTGGCGGTGGTGGTGGTGGCAGG - Exonic
1060745740 9:126129736-126129758 GTGGCAGTGGTGGTGGTGGCAGG + Intergenic
1060825169 9:126683609-126683631 GTGGCTGAGGTTATGGTTGTGGG - Intronic
1061255884 9:129454054-129454076 GTGGTGGAGGTGGAGGTGGTGGG + Intergenic
1061255892 9:129454076-129454098 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061255903 9:129454107-129454129 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061255920 9:129454152-129454174 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061255935 9:129454191-129454213 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061255946 9:129454222-129454244 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061255982 9:129454321-129454343 GTGGTGGAGGTGGTGGTGGGTGG + Intergenic
1061256032 9:129454452-129454474 GTGGAGGTGGTGGAGGTGGTGGG + Intergenic
1061256108 9:129454680-129454702 GTGGCAGAGGTGGCAGTGGTGGG + Intergenic
1061392023 9:130321944-130321966 GTCTCGGAGGTGGTGGTCGTGGG + Intronic
1062248855 9:135584216-135584238 GTGGGGGTGGCGAGGGTGGTGGG - Intergenic
1062360664 9:136186494-136186516 CTGGCGGAGGCGGTGGTGGTCGG - Intergenic
1203767975 EBV:36410-36432 GTGGTGGGGGTGGTGGTGGGGGG - Intergenic
1203767984 EBV:36425-36447 GTGGGGGTGGTGGGGGTGGTGGG - Intergenic
1203767989 EBV:36434-36456 GTGGGGGTGGTGGGGGTGGTGGG - Intergenic
1203767994 EBV:36443-36465 GTGGGGGTGGTGGGGGTGGTGGG - Intergenic
1203767999 EBV:36452-36474 GTGGAGGTGGTGGGGGTGGTGGG - Intergenic
1185831558 X:3307923-3307945 GTGGAGGAGGAGGTGGTGCTTGG - Intergenic
1185930852 X:4202038-4202060 TTGGGGGAGGTGATGGATGTGGG + Intergenic
1186850098 X:13571107-13571129 GTGGTGGTGGTGGTGGTGGGGGG - Intronic
1186850101 X:13571110-13571132 TTGGTGGTGGTGGTGGTGGTGGG - Intronic
1187203296 X:17156894-17156916 GAGGCAGAGGTAATGGTGGAGGG + Intergenic
1187697494 X:21936888-21936910 GTGAGGGAGCTGATGGGGGTTGG - Intergenic
1187929924 X:24284638-24284660 TTGGGGGGGGTGGTGGTGGTGGG + Intergenic
1187953859 X:24496697-24496719 GTGACCAAGGGGATGGTGGTGGG - Intronic
1188528939 X:31116198-31116220 ATGGTGGAGGTGCTGTTGGTTGG + Intronic
1189099088 X:38170834-38170856 GGGGCAGAGGTGATGGTGGGAGG - Intronic
1190301064 X:49057863-49057885 GTGGTGATGGTGGTGGTGGTGGG + Intronic
1190385508 X:49879555-49879577 GAGGCGGAGGCGAAGGTGGAGGG + Intergenic
1190736499 X:53258873-53258895 TTGGTGGTGGTGGTGGTGGTGGG - Intronic
1190738167 X:53269438-53269460 GTGGAGGAGGTAATGGGGATGGG - Intronic
1190742561 X:53299507-53299529 GTGGGGGAGTTGAAGGAGGTTGG + Intronic
1190935340 X:54994444-54994466 GAGGCAAAGGTGATGGAGGTAGG + Intronic
1192053252 X:67746311-67746333 GTGGGGGCGGTGGGGGTGGTAGG + Intergenic
1192553337 X:72070729-72070751 GTGGTGGTGGTGGGGGTGGTGGG - Intergenic
1192631381 X:72780421-72780443 CTGGAGGTGGTGGTGGTGGTGGG + Intronic
1192650328 X:72940380-72940402 CTGGAGGTGGTGGTGGTGGTGGG - Intronic
1193263625 X:79440861-79440883 GTGGTGGTAGTGGTGGTGGTAGG + Intergenic
1193654549 X:84183814-84183836 GGGGTGGTGGTGGTGGTGGTGGG - Intronic
1193669227 X:84363864-84363886 GTGGCTGAGGTGAAGGAGGGAGG + Intronic
1194746615 X:97635361-97635383 GTGGTGGTGGTGGTGGTGGTTGG - Intergenic
1194748468 X:97656511-97656533 GGGCCGGTGGTGGTGGTGGTGGG + Intergenic
1195333903 X:103831256-103831278 TTGGCGTTGGTGCTGGTGGTGGG + Intronic
1195767175 X:108308117-108308139 GTGGCTGAGGGGATGGAGGATGG - Intronic
1196044798 X:111246036-111246058 GTGGTGGTGGTGGTCGTGGTTGG + Exonic
1196373148 X:115001102-115001124 GTGGGGCAGGTGGTGGTGGTAGG + Intergenic
1196786772 X:119427656-119427678 GTGGGGGAGGTGGTTGTGGCAGG - Intronic
1196950260 X:120869809-120869831 GAGGCTGCAGTGATGGTGGTAGG - Intergenic
1197297519 X:124737135-124737157 GAGGCGGAGGTGGCGGTGGGAGG + Exonic
1197594632 X:128450938-128450960 GTGGTGGTGGTGGTGGTGGTGGG + Intergenic
1197830718 X:130639327-130639349 GGGTGGGGGGTGATGGTGGTGGG + Intronic
1197997831 X:132398790-132398812 GTGGTGGTGGTGGTTGTGGTTGG - Intronic
1198541063 X:137640051-137640073 GTGGTGGTGGTGATGGTAGGTGG - Intergenic
1199057803 X:143318783-143318805 CTGGTGGAGGTGGTGGGGGTGGG + Intergenic
1199122429 X:144071392-144071414 TTGGGGGGGGTGGTGGTGGTTGG + Intergenic
1199486824 X:148357489-148357511 ATGGCTCAGGTGAAGGTGGTTGG - Intergenic
1199554874 X:149095927-149095949 GTGGAAGAGCTGATGGTTGTAGG + Intergenic
1199761038 X:150904168-150904190 TTGGTGGTGGTGGTGGTGGTAGG - Intergenic
1200017837 X:153179703-153179725 GTAGCTGAGGAGATGGGGGTTGG - Intronic
1200073930 X:153542062-153542084 GTGGCGGGGGTGGGGGAGGTGGG + Intronic
1200152366 X:153957451-153957473 GTGGTAGTGATGATGGTGGTGGG + Exonic
1200366236 X:155667607-155667629 ATGGTGGTAGTGATGGTGGTGGG + Intronic
1201157136 Y:11141387-11141409 GTGTGGTAGGTGGTGGTGGTTGG + Intergenic