ID: 1124468322

View in Genome Browser
Species Human (GRCh38)
Location 15:29960710-29960732
Sequence TTCCTGTGGAGTCTGTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124468322_1124468330 28 Left 1124468322 15:29960710-29960732 CCTGCCCACAGACTCCACAGGAA 0: 1
1: 0
2: 2
3: 27
4: 296
Right 1124468330 15:29960761-29960783 GGCTTCTACAGAGTAACTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 138
1124468322_1124468328 7 Left 1124468322 15:29960710-29960732 CCTGCCCACAGACTCCACAGGAA 0: 1
1: 0
2: 2
3: 27
4: 296
Right 1124468328 15:29960740-29960762 CCTTGTCTAAGAATTTAACCAGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124468322 Original CRISPR TTCCTGTGGAGTCTGTGGGC AGG (reversed) Intronic
900290799 1:1922837-1922859 TTCCTGTGGCAGCTGTGGGGTGG - Intronic
901254855 1:7814549-7814571 TTCTTGTGGAGTAAGTGTGCTGG - Intronic
902186103 1:14726531-14726553 TTCCTCGAGTGTCTGTGGGCTGG + Intronic
902370924 1:16006316-16006338 CTCCTCTTGTGTCTGTGGGCAGG + Exonic
903929830 1:26855808-26855830 TTCCTGGGGAGACTGTGAGAAGG + Exonic
904326697 1:29731188-29731210 CTCCTGCAGAGTGTGTGGGCAGG + Intergenic
904371766 1:30052166-30052188 CTCCTGCAGAGTGTGTGGGCAGG - Intergenic
904387209 1:30151204-30151226 TTCCTGTACAGCCTGTGGGAGGG + Intergenic
906249963 1:44303396-44303418 TTCCTGTGGAATCTCTGCTCAGG - Intronic
906787676 1:48630085-48630107 TGCCTGTGGACACTGTGGCCTGG - Intronic
907133605 1:52118867-52118889 GTCCTGTGGGACCTGTGGGCTGG + Intergenic
912450466 1:109764853-109764875 GTCCTGTGGAGTCTGAGGGCTGG + Intronic
912521078 1:110245105-110245127 CTCATGGGGAGGCTGTGGGCTGG - Intronic
913326885 1:117635298-117635320 TTCCTGTGGGGGCAGTGGGTAGG + Intergenic
913505504 1:119513078-119513100 TTCCTGTGGAGCCTGGTGGAGGG - Intronic
914346009 1:146799159-146799181 TGCCTGTGGAGTCTGCATGCTGG - Intergenic
916579862 1:166097385-166097407 TGCCTGTGCAGTCTGTATGCTGG - Intronic
916906228 1:169287366-169287388 TTCAAGTGGAGGTTGTGGGCCGG - Exonic
917159238 1:172039060-172039082 TTCCTGTGGTGTCTTGGGGTAGG + Intronic
918420450 1:184359491-184359513 ATCCTCTGGATTCTGTGGTCTGG + Intergenic
918844130 1:189586681-189586703 TTCTTCTGAAGTCTGTGGGGGGG + Intergenic
919355487 1:196516569-196516591 TGCCTGAGGGGCCTGTGGGCTGG + Intronic
919629143 1:199943063-199943085 GACCTGTGAAGTCTGTAGGCAGG - Intergenic
920679241 1:208060113-208060135 CTGCTGTGGAGTTGGTGGGCAGG - Intronic
921162525 1:212483290-212483312 GGCCCGTGGAGACTGTGGGCAGG + Intergenic
922657855 1:227401678-227401700 TACCTGTGGAGTCTGCACGCTGG - Intergenic
924127548 1:240870962-240870984 TTCCTGAGGAGTCGATGGCCTGG + Intronic
924141367 1:241027242-241027264 TTCATGTGGAGTGTGGTGGCAGG + Intronic
1062842211 10:680163-680185 TTCCTGAGGAGTCTGTGCCAGGG - Intronic
1062906455 10:1182923-1182945 TTCCTGTGGAGTCTGAGGGAGGG - Exonic
1063945306 10:11170309-11170331 TTACTGAGAAGTCTGAGGGCAGG - Intronic
1065186431 10:23174250-23174272 TACCTGTGGAGTGGGTGGCCCGG - Intergenic
1065316309 10:24467261-24467283 TCCGTGTGCAGTCTGTGGGCAGG + Intronic
1068871609 10:61950932-61950954 TTCCAGTGGGTTCTGTGAGCAGG + Intronic
1070128876 10:73642987-73643009 TTCCAGCGGAGTCTCTGGGCAGG + Intergenic
1071384278 10:85104010-85104032 TTCCTGTGGAGGCTCTGAGAAGG - Intergenic
1072614438 10:97040074-97040096 CTCCTGTGGGCACTGTGGGCGGG + Exonic
1072617542 10:97059701-97059723 TCCCTGTGCAGTCTGAGGGCTGG + Intronic
1073709510 10:106021250-106021272 TTGCTGTGGGGTTTGAGGGCTGG + Intergenic
1074962157 10:118456490-118456512 TTCTTTTGGATTCTGTGAGCAGG + Intergenic
1076322178 10:129591383-129591405 TTCCTGGGGAGACAGAGGGCAGG - Intronic
1076560829 10:131362256-131362278 TTGGTGTGGAGTCTGTGGGAGGG - Intergenic
1077245012 11:1532545-1532567 TGGCTGTGCAGGCTGTGGGCTGG - Intergenic
1077322071 11:1947089-1947111 GTCCTGTGGAGTCTGCGGCGCGG + Intergenic
1077511805 11:2969443-2969465 TTCCTGTGGTGTGAGTGTGCAGG - Intronic
1078874061 11:15376289-15376311 TCCCTCTGGAGTCTGAGGGGTGG + Intergenic
1079791772 11:24748019-24748041 TTCCTGTGGAGTCTGCAAGCTGG + Intronic
1083050398 11:59771415-59771437 CTCCTGGAGATTCTGTGGGCGGG - Intronic
1083716577 11:64580903-64580925 TTCCTCTGGAGCCTGTGCCCAGG - Intergenic
1084606804 11:70177094-70177116 TTCCTGTTGTCTCTCTGGGCCGG + Intronic
1087665886 11:101047395-101047417 TTCCAGTTGACTCTCTGGGCCGG + Intronic
1088206361 11:107397192-107397214 TGCCTGTGAAGTCTGTACGCAGG - Intronic
1089011599 11:115136239-115136261 TGGCTGTGGAATCTCTGGGCTGG - Intergenic
1089473791 11:118742067-118742089 TTCCTGGGGATCCAGTGGGCTGG - Intergenic
1090077104 11:123586484-123586506 TTGCTGAGGAGTGTGTGGGGCGG + Intronic
1090843769 11:130514547-130514569 TTCCTGTGGGCTCACTGGGCAGG - Intergenic
1202805087 11_KI270721v1_random:2402-2424 GTCCTGTGGAGTCTGCGGCGCGG + Intergenic
1092046484 12:5434566-5434588 TTTCTGGGGAGTCTGTCGGATGG + Intronic
1092089193 12:5790205-5790227 CTCCTGGGGAGTCTCTGGGAAGG - Intronic
1094490918 12:30960108-30960130 ACCCTGTGGTGTCTGTGGGTGGG + Intronic
1095701280 12:45193587-45193609 TTCCTGTGAATTCTGAGGTCTGG + Intergenic
1096997436 12:55847651-55847673 ACCCTGTGGAGGCAGTGGGCAGG + Intergenic
1097081351 12:56433507-56433529 TTCCTTTGGAGTCCCTGGGGTGG - Intronic
1100714921 12:97295503-97295525 TTCGTATGGAGACTTTGGGCTGG - Intergenic
1103520100 12:121532517-121532539 TTCCTGTGGAGATTGTGTGTTGG - Intronic
1104534505 12:129606284-129606306 AGACTGTGGAGTCTGTGGACCGG - Intronic
1104959005 12:132479364-132479386 TTCCTCTGCAGGCTGTGGGAGGG + Intergenic
1105039745 12:132953361-132953383 AGTCTGTGGAGTCTGTGGTCAGG - Intronic
1108319880 13:49279250-49279272 GTGCTGTGGATTCTGTGGGAGGG + Intronic
1113387161 13:109859393-109859415 TTGTGGTGGAGTCTGTGGGGCGG + Intergenic
1115969758 14:38932307-38932329 TGCCTGTGGAGTCTGTACGCAGG - Intergenic
1117797255 14:59407167-59407189 TTCCTGTGGAGATTGTGAGTTGG - Intergenic
1118072931 14:62265489-62265511 TTCCTGAGAAGTCCCTGGGCAGG + Intergenic
1118165539 14:63332315-63332337 TGCCTGTGGAGTCTGTACCCTGG - Intergenic
1118842578 14:69524209-69524231 TCCCTGTGGAGACAGAGGGCTGG - Exonic
1122266988 14:100551176-100551198 TGCCTGTGGCCTATGTGGGCTGG + Intronic
1123939684 15:25210824-25210846 TGCCTGGTGAGGCTGTGGGCCGG + Intergenic
1124139454 15:27064447-27064469 TTCCTGAGGAGCCAGTGGGCTGG - Intronic
1124226890 15:27902733-27902755 TTCCTCTGCAGGCTGGGGGCGGG + Intronic
1124468322 15:29960710-29960732 TTCCTGTGGAGTCTGTGGGCAGG - Intronic
1125434399 15:39629566-39629588 TTCCTGAGGAGGGTGTGCGCAGG - Intronic
1126512110 15:49489523-49489545 TTCATGTTGAGTCTGATGGCAGG - Intronic
1127405744 15:58643921-58643943 TTCCGGAGAAGTCTGTGGTCTGG + Exonic
1127640951 15:60915312-60915334 TGCCTGTGGAGGCAGTGGCCAGG - Intronic
1128921583 15:71615277-71615299 TTCCTTTGGAGTCTCTGACCAGG - Intronic
1129051095 15:72782661-72782683 TTTCTGTGGAGTGTTGGGGCCGG - Intronic
1129702193 15:77774426-77774448 TGCTTGTGGTGTCTGGGGGCTGG - Intronic
1131257947 15:90873762-90873784 GTCCTGTGGAGTCTGCCCGCAGG + Intronic
1133916427 16:10113233-10113255 TTCCTGGGGGGGCTGGGGGCAGG - Intronic
1134070489 16:11256809-11256831 TTCCTCTGAAGCCTGTGGTCAGG - Intronic
1136404565 16:30036660-30036682 TTCCTGTGGGGGCTGGGGGGCGG + Intronic
1136510956 16:30738094-30738116 TTCCTGTGGCTTCTCTGGGCTGG - Exonic
1137057385 16:35752159-35752181 TGCCTGGGGAGACTGGGGGCTGG + Intergenic
1138511774 16:57512859-57512881 TGCCTGCGGAGCCTGTGGGGTGG + Exonic
1138654087 16:58480606-58480628 TTCCTATGGCTTCTGTGGACAGG + Intronic
1139987972 16:70916108-70916130 TGCCTGTGGAGTCTGCATGCTGG + Intronic
1141390128 16:83657595-83657617 TTGCTGGAGAGGCTGTGGGCTGG + Intronic
1142249051 16:88982835-88982857 TTCCTATGGGCTCTGAGGGCTGG - Intergenic
1142268054 16:89073824-89073846 TTCCTGAGTAGTATGTGTGCAGG + Intergenic
1142374563 16:89700491-89700513 TCCCTGTGAAGTCTCAGGGCTGG - Intronic
1142564728 17:832653-832675 TGTCTGTGGAGACTGGGGGCAGG - Intronic
1142636650 17:1261781-1261803 TTCATGTGGTGTCTCTGGTCAGG + Intergenic
1144337984 17:14288700-14288722 TTCCTGTGGAGTTTTTGCTCTGG - Intergenic
1146758369 17:35453549-35453571 TTGCTTTTGAGTCAGTGGGCTGG + Intergenic
1147537652 17:41331496-41331518 TTCCTGTTGAGTCTGAGGAAGGG - Intergenic
1147588031 17:41664155-41664177 TGCCTCAGGAGCCTGTGGGCAGG - Intergenic
1148013680 17:44505762-44505784 TCTCTGTGGAGTATTTGGGCAGG - Intergenic
1149570203 17:57667009-57667031 TTCCTGTGGAGTCTCAGACCTGG + Intronic
1149664249 17:58354666-58354688 TGCCTGTGGCGTGTGTGGGCTGG - Exonic
1151444458 17:74154033-74154055 TTCCTGGTGAGTAGGTGGGCCGG - Intergenic
1152119290 17:78408400-78408422 TTCCTGTGCAGTCGGGGGGATGG + Intronic
1152352418 17:79791122-79791144 TTGCTGAGGAGTCAGTGGCCCGG - Intergenic
1154487349 18:14883679-14883701 TTCATGTTGAGTCTGATGGCAGG + Intergenic
1157734707 18:50036801-50036823 CTCCTGAGTAGTCAGTGGGCAGG - Intronic
1160367130 18:78335708-78335730 TTCCTGTGGATCTTGTGGGTGGG + Intergenic
1161766214 19:6210336-6210358 CTCCTGTCCAGTCAGTGGGCAGG - Intergenic
1162359208 19:10207461-10207483 ATCCTGTGGTTTCTGTGGGCTGG - Intronic
1163157546 19:15447764-15447786 TACCTGTGGAATAAGTGGGCTGG + Intronic
1163688254 19:18724562-18724584 TTCCTCTGGAGGCTCTGGGGAGG + Intronic
1164465589 19:28484943-28484965 CTCCTGTGGACTGTGTGGGTAGG - Intergenic
1166809615 19:45507615-45507637 TTCCTGGGGAGAATGTGGACCGG - Exonic
1167097320 19:47381292-47381314 ATCCTGTGGGGCCTGGGGGCAGG - Exonic
1167327246 19:48834345-48834367 TCCCTGCAGAGTCTGGGGGCCGG - Exonic
925999380 2:9318090-9318112 TTGCTGTGGAGACTGGGGCCTGG + Intronic
928403422 2:30995942-30995964 TTCCAGTGGAGTCTGAACGCAGG + Intronic
929191780 2:39146948-39146970 ATCAGGTGGAGTCAGTGGGCTGG - Intergenic
929573808 2:43039858-43039880 TTGCTGTGGTGTGTGTGGGAGGG - Intergenic
930088820 2:47517277-47517299 TTCCTGTGGACTCTGGGGTGAGG - Exonic
931372766 2:61679186-61679208 TTCCTGAGGAGTCTGAGGCTAGG - Intergenic
932261831 2:70333359-70333381 AGCCTCTGGAGTGTGTGGGCAGG + Intergenic
934615507 2:95768270-95768292 TTCCTGTGGAATCTGGAGTCTGG - Intergenic
934645392 2:96056288-96056310 TTCCTGTGGAATCTGGAGCCTGG + Intergenic
934838796 2:97612377-97612399 TTCCTGTGGAATCTGGAGCCTGG + Intergenic
935697998 2:105786647-105786669 TCCCTGTGGTGGCTGTGGCCTGG + Intronic
935714354 2:105926890-105926912 TTTCTCTCGAATCTGTGGGCTGG - Intergenic
936495379 2:113015910-113015932 TTCCTGTTGAGGCTTTGGGTGGG - Intergenic
936503969 2:113090021-113090043 GACCCATGGAGTCTGTGGGCAGG - Intergenic
937223387 2:120354522-120354544 GTCGTGTGGGGACTGTGGGCGGG + Intergenic
937904996 2:127048816-127048838 CTCCTGTGGTGCCTCTGGGCAGG - Intronic
938611237 2:132949484-132949506 TTACTGTGGTTTCTGTGGGAAGG - Intronic
939276170 2:139999222-139999244 TTGATTTGGAGTATGTGGGCAGG - Intergenic
939832784 2:147092686-147092708 TTGTTCAGGAGTCTGTGGGCTGG + Intergenic
940182917 2:150955122-150955144 TTGCTGTGGGGTTTGAGGGCCGG - Intergenic
940711192 2:157165238-157165260 TCCGTGTGGAGTCTGTGACCTGG - Intergenic
941942449 2:171056428-171056450 TTCATGTGTAGTCTTTGGGAGGG - Intronic
943338529 2:186648294-186648316 TTCCTGTGGAGGGAGTGGGATGG - Intronic
944984677 2:205161899-205161921 TTCCTGTGCATTCTGTGTGCTGG + Intronic
946854230 2:223936902-223936924 TTCCTGTGGAGTCACAGGACAGG - Intronic
948001354 2:234570402-234570424 TTCCTGTGGTTTGGGTGGGCTGG - Intergenic
948677095 2:239603049-239603071 TGGCTGTGGAGTCTGAGGACAGG + Intergenic
948863601 2:240764477-240764499 TGCCTGTGGGGTCCCTGGGCAGG - Intronic
948936260 2:241166887-241166909 GTCCTGTGCTCTCTGTGGGCTGG - Intronic
1171160361 20:22916713-22916735 TGCCTGTGGAGTCTGCATGCTGG + Intergenic
1171771300 20:29325172-29325194 TTTCTGTGGAGTCTCTCGCCGGG - Intergenic
1172296454 20:33814547-33814569 CGCCTCTGGAGTCTGTGGGTGGG + Intronic
1172442896 20:34978229-34978251 TTCCTGCAGAGTCTGGGGCCTGG + Intronic
1172901402 20:38337496-38337518 TTCATGTGGATTCTGTGTGCTGG + Exonic
1173645352 20:44629762-44629784 TTGGTGTGGCGGCTGTGGGCAGG - Intronic
1174506328 20:51020035-51020057 TTCCTGGGGAGATTGTGTGCTGG + Intronic
1175983710 20:62753995-62754017 TTGCGCTGGAGTCTTTGGGCAGG + Intronic
1176038927 20:63054297-63054319 CTCCTGTGGAGGCTCTGGGAGGG + Intergenic
1176793932 21:13355656-13355678 TTCATGTTGAGTCTGATGGCAGG - Intergenic
1177806052 21:25875769-25875791 TTCCTGTTCATTCTGTGGGCAGG - Intergenic
1178643326 21:34364132-34364154 TACCTATGCAGTGTGTGGGCAGG - Exonic
1179143427 21:38747396-38747418 TTCCTGTGCAGCCTGTGGAACGG - Intergenic
1180801811 22:18635447-18635469 CTGCTGTGGAGTCTGTGTGGAGG - Intergenic
1180853051 22:19030988-19031010 CTGCTGTGGAGTCTGTGTGGAGG - Intergenic
1181219911 22:21359814-21359836 CTGCTGTGGAGTCTGTGTGGAGG + Intergenic
1182619450 22:31610860-31610882 CCCCTGTGGAGGCTGTGGACAGG + Intronic
1183391824 22:37549745-37549767 TCCTGGTGGAGTCTGTGTGCTGG - Intergenic
1184203946 22:42988747-42988769 TTTCTTTGGAATGTGTGGGCTGG - Intronic
1184902539 22:47456782-47456804 TTCCAGCGGAGGCTGTGGACAGG - Intergenic
1185223640 22:49641217-49641239 TCCCTGGGGTGTCTGTGGGCAGG - Intronic
949564151 3:5229518-5229540 TTCCTGTGCAGCCTGTGGAACGG + Intergenic
950419969 3:12892797-12892819 TCCCTGTGGAGGTTGTGGGGGGG - Intergenic
950420018 3:12892924-12892946 TCCCTGTGGAGGTTGTGGGTGGG - Intergenic
953107454 3:39898112-39898134 TGCCTTTGCAGTCTGTGGGTAGG + Intronic
954499961 3:51003287-51003309 TTACTCTGTAGTCTGTAGGCTGG + Intronic
954686047 3:52370838-52370860 TCCCTGTGCAGTCTCTGGGGAGG - Intronic
955357300 3:58241692-58241714 TGCCTGAGTAGTCTCTGGGCAGG - Intronic
955398568 3:58574815-58574837 ATCCTGTGGAGCCTGTGGCAAGG - Intronic
955736909 3:62048348-62048370 TTGCTGTTGAGTCTTTGGGGTGG + Intronic
956340171 3:68213547-68213569 TCCCTGTGGAGTCAGGGGGTAGG + Intronic
957900300 3:86480991-86481013 GTCCTGTGGAGTCTCAGGCCAGG - Intergenic
961987780 3:131156271-131156293 GTCCTCTGGAGTCTGTTGTCTGG + Intronic
962276501 3:134018543-134018565 TCCCGGTGGAGACTGAGGGCTGG - Intronic
963897176 3:150699405-150699427 TTCCTGTGGAGTGTCTAGGCAGG - Intronic
968442416 4:630595-630617 TTCCTGGGGAGCCCCTGGGCTGG + Intronic
968956651 4:3722943-3722965 TTGCTCTTGAGTCTGTGAGCTGG + Intergenic
969570658 4:8006349-8006371 TCCCTGAAGAGTCTGTGGGGAGG + Intronic
969595500 4:8147294-8147316 TCCCTGTGGAGTCTCTAGGATGG - Intronic
971703766 4:30013196-30013218 TTGCTGTTGCGGCTGTGGGCAGG + Intergenic
973002873 4:44973643-44973665 TTAATGTTGAGTCAGTGGGCTGG + Intergenic
973179638 4:47251953-47251975 TGCCTGTGGAGTCTGCATGCTGG + Intronic
974489525 4:62546880-62546902 TTTTTGTGGATTCTGTGGGATGG - Intergenic
974607706 4:64174097-64174119 TCCCGGTGGAGTCTGTGGCCTGG + Intergenic
978282437 4:107035082-107035104 TTCCTGTGGAGAAAGTGGTCAGG - Intronic
979023859 4:115542050-115542072 TTCCTGTGGAATTTATGGCCAGG - Intergenic
979289228 4:118961287-118961309 CTCCTGTGGAATCTGTAGGCTGG - Intronic
980164490 4:129208725-129208747 TTTCTTGGGATTCTGTGGGCTGG - Intergenic
981169884 4:141609687-141609709 TTCCTTTGGAGTAAGTAGGCAGG - Intergenic
981543547 4:145871350-145871372 TTGCTGTGGAGTGTGTGGTCAGG + Intronic
982807619 4:159786256-159786278 TACCATTGGAGTCAGTGGGCTGG + Intergenic
987112610 5:14701487-14701509 GTCCTGGGGACTCAGTGGGCTGG - Intergenic
987238418 5:15967949-15967971 TACGTGGGGAGTTTGTGGGCAGG - Intergenic
987288430 5:16484192-16484214 TTCCTGTGGAAAATGAGGGCAGG - Intronic
988523205 5:31964512-31964534 TTTCTGTTCAATCTGTGGGCTGG - Intronic
988896331 5:35678502-35678524 TTCCAGAGGAGCCAGTGGGCAGG - Intronic
989191322 5:38672365-38672387 TTCCTGTGAAGAGTGTGGCCAGG - Intergenic
989767121 5:45100683-45100705 TTTTTGTGCAGTCTGTGGTCCGG - Intergenic
990532711 5:56689677-56689699 TGCTTTTGGACTCTGTGGGCTGG - Intergenic
991498185 5:67248805-67248827 TTCCTGTGGTCTCTGGGAGCTGG - Intergenic
992147767 5:73869198-73869220 TTCCTGAGGAGTGTGTGTGTGGG + Intronic
995769352 5:115652580-115652602 TTCTTGTGGGGTTTGAGGGCTGG - Intergenic
996276784 5:121676298-121676320 TTTCTGGTGACTCTGTGGGCTGG - Intergenic
997003525 5:129790926-129790948 TTCCTGTAGAGTAGGTGCGCTGG - Intergenic
999450798 5:151676459-151676481 TTCCTGTGGAAGCTCTGAGCTGG - Intronic
999453606 5:151696848-151696870 GTCCTCTGGGGTCTCTGGGCTGG + Intergenic
1000043080 5:157499660-157499682 TTCCTGGGGAGGCAGTGGGGTGG + Exonic
1000185489 5:158853999-158854021 GCCCTGTGGAGTCAGTCGGCTGG - Intronic
1003280849 6:4690228-4690250 TTCCTGTAGAGCCTGTGGAATGG - Intergenic
1004014315 6:11718390-11718412 TTCCTGAGGAGCTTGTGTGCTGG + Intronic
1004426218 6:15509065-15509087 ACCCTGTGGAGTCTGTTGCCTGG + Intronic
1005601377 6:27429745-27429767 TCTCTATGGACTCTGTGGGCAGG + Intergenic
1005760216 6:28960953-28960975 TACCTGTGGAGTCTGCATGCTGG - Intergenic
1006561559 6:34917318-34917340 TTCCTGTGTAGTTTGTGGAGAGG + Intronic
1006731862 6:36242257-36242279 TTCCTGAGGAGTCTATGAGGTGG - Intergenic
1007362975 6:41371880-41371902 TTCCCGGGGAGGCTGGGGGCAGG + Intergenic
1008428317 6:51384864-51384886 CACTTGAGGAGTCTGTGGGCAGG + Intergenic
1009720865 6:67467549-67467571 TTCCTGTGGTTTCTGGGAGCAGG - Intergenic
1010165162 6:72906362-72906384 TGCCTGTGGAGTCTGCACGCTGG + Intronic
1010667374 6:78646406-78646428 TTCCTGTGGTGTATGTGTCCAGG + Intergenic
1010679271 6:78780988-78781010 TGCCTGTGGAGTCTGCACGCTGG - Intergenic
1011366947 6:86593079-86593101 TTCATGTGAAGGCTGTGGGTAGG - Intergenic
1012703167 6:102488936-102488958 TTCTTGTGGTTTCTGTGGGAAGG + Intergenic
1013208517 6:107966158-107966180 TTGTTGTGGAGGCTGTGGGTTGG - Intergenic
1013539122 6:111089886-111089908 ATCCTTTGGTGTCTGTGGGTGGG + Intronic
1015031883 6:128604878-128604900 TTCTTCTTGAGTCTGTGTGCTGG + Intergenic
1016563713 6:145427256-145427278 GGCATGTGGAGTCTGTGGGGAGG + Intergenic
1017504159 6:155052111-155052133 TACCTGTGGTCTCTGTGGGAAGG + Intronic
1018651535 6:165995777-165995799 TTCCTATAGAGTCTGGGGGTGGG - Intergenic
1018888760 6:167965746-167965768 TTCCTGTCGCCTCTGCGGGCGGG - Intronic
1019014108 6:168867387-168867409 GTCCTGTGGTGTCTGAGGGCAGG - Intergenic
1019094016 6:169564351-169564373 TACCATTGGAGTCTGTGAGCTGG - Intronic
1019326273 7:439874-439896 TTACTGTGCACTGTGTGGGCTGG + Intergenic
1019347866 7:539436-539458 CTCCCTTGGAGTGTGTGGGCAGG - Intergenic
1019416894 7:931997-932019 TTGCTGGGGACTCTGTGGGGCGG - Intronic
1019808760 7:3148980-3149002 TTCCTGTATAGTCTGTGGAACGG - Exonic
1020019144 7:4852119-4852141 TTTCTGAAGAGCCTGTGGGCCGG - Intronic
1020139586 7:5605261-5605283 TGCCTGTGGAGTCTGGGGAGGGG - Exonic
1021764024 7:23928898-23928920 TTCCACTGCAGTCTGGGGGCGGG - Intergenic
1024127746 7:46317996-46318018 TTCCAGTGTAGTCTGAGTGCTGG - Intergenic
1025992732 7:66507804-66507826 TTGCTGTGGGGGCCGTGGGCAGG - Intergenic
1027911813 7:84260916-84260938 TCCAGGTGGAGTCTGTGGCCAGG + Intronic
1028422194 7:90645992-90646014 TATGGGTGGAGTCTGTGGGCAGG + Intronic
1029635430 7:101780489-101780511 TGGCTGTGGAGCCTGTGGGATGG + Intergenic
1029975343 7:104828343-104828365 TTCTTGTGAATTCAGTGGGCAGG - Intronic
1030084110 7:105802707-105802729 TTCCTCTGGATTCTGTGGCTGGG - Intronic
1030259242 7:107544597-107544619 TTCTGGTGTGGTCTGTGGGCAGG - Intronic
1030735912 7:113048412-113048434 TTCCTGTGGAAACTGAAGGCCGG + Intergenic
1032715542 7:134506062-134506084 TTCTTGTGCAGTATGTGGGATGG - Intergenic
1032978526 7:137253560-137253582 CACCAGTGGAGACTGTGGGCTGG - Exonic
1035074527 7:156169191-156169213 TTCCTGGGGGGACAGTGGGCGGG + Intergenic
1035300508 7:157894362-157894384 TTCCTGTGGAAGCTGAGAGCTGG + Intronic
1035300513 7:157894393-157894415 TTCCTGTGGAAGCTGAGAGCTGG + Intronic
1035300518 7:157894424-157894446 TTCCTGTGGAAGCTGAGAGCTGG + Intronic
1035300523 7:157894455-157894477 TTCCTGTGGACGCTGAGAGCTGG + Intronic
1035300528 7:157894486-157894508 TTCCTGTGGACGCTGAGAGCTGG + Intronic
1035300533 7:157894517-157894539 TTCCTGTGGAAGCTGAGAGCTGG + Intronic
1035300538 7:157894548-157894570 TTCCTGTGGAAGCTGAGAGCTGG + Intronic
1035300543 7:157894579-157894601 TTCCTGTGGAAGCTGAGAGCTGG + Intronic
1035300548 7:157894610-157894632 TTCCTGTGGAAGCTGAGAGCTGG + Intronic
1035300553 7:157894641-157894663 TTCCTGTGGAAGCTGAGAGCTGG + Intronic
1035312426 7:157977904-157977926 TTCCCGATGTGTCTGTGGGCCGG + Intronic
1037889472 8:22615926-22615948 GTCTTGGGGAGGCTGTGGGCTGG + Intronic
1038980085 8:32750420-32750442 GCCCTGTGGAGTCTCTGGGAAGG - Intronic
1039007207 8:33052935-33052957 TTTCTGTGGAGTCAGTGGTTAGG - Intergenic
1040414975 8:47187829-47187851 GTCCTGTGGACACTGTGGCCTGG - Intergenic
1041529626 8:58850374-58850396 TTACTGGGGATTTTGTGGGCAGG + Intronic
1042435921 8:68764435-68764457 TACCAGTGCAGTCAGTGGGCAGG + Intronic
1042760868 8:72270180-72270202 TTCATGTGGAATCTGTGAGTGGG - Intergenic
1043542129 8:81275961-81275983 GTCCTGTGGTGTCTATGGGTGGG + Intergenic
1043643620 8:82488936-82488958 TGCATGTGGGGTCTGTGGGCAGG + Intergenic
1045209740 8:100084156-100084178 TTACTGTGGATGCTGTGGACTGG + Intronic
1047358502 8:124145667-124145689 TTCCTGTTGGGTCTGTGCCCAGG - Intergenic
1049019016 8:139941192-139941214 CTCCTGTGAAGGCTGAGGGCCGG - Intronic
1049084857 8:140470713-140470735 TTCCTGTGGATTGTGAGGGATGG - Intergenic
1049346931 8:142144124-142144146 GCCCTGTGGAGGCTGTGGCCAGG + Intergenic
1049745727 8:144262492-144262514 TTCTTGTGGTGTCTGGGGGGAGG + Exonic
1049995373 9:1029236-1029258 TTCCTGTGGTTGCTGTGTGCAGG + Intergenic
1050410890 9:5363611-5363633 TTCCTGTGGAGAATGTTGGGAGG - Intronic
1051371716 9:16364729-16364751 TTCCTGAGGCATCTGTGGCCTGG - Intergenic
1052037077 9:23694738-23694760 TTTCAGTGGAGACTGAGGGCAGG - Intronic
1052941113 9:34132809-34132831 TTCCTGGGGGGGCTGGGGGCAGG + Intergenic
1053136139 9:35651127-35651149 TCCCTGAGGACTCTGAGGGCGGG + Intergenic
1053157866 9:35792560-35792582 TAGCTGTGGAGGCTCTGGGCCGG + Exonic
1053884389 9:42631868-42631890 TTCATGTTGAGTCTGATGGCAGG - Intergenic
1053888279 9:42662426-42662448 TTCATGTTGAGTCTGATGGCAGG + Intergenic
1054223413 9:62439315-62439337 TTCATGTTGAGTCTGATGGCAGG - Intergenic
1054227298 9:62469872-62469894 TTCATGTTGAGTCTGATGGCAGG + Intergenic
1054800880 9:69347172-69347194 TTCCTATGGCCTCTCTGGGCAGG - Intronic
1056268792 9:84925908-84925930 TGCCTGTGGAGTGTGTGAGCTGG + Intronic
1058670668 9:107358188-107358210 TTCCTGTGTTTTCTGTGGGGAGG + Intergenic
1059353787 9:113684528-113684550 TGCATGTGGTGTCTGAGGGCAGG - Intergenic
1059471172 9:114505549-114505571 TTCCTGAGGAGCCCGTGGGGAGG - Intergenic
1061021010 9:128014758-128014780 CCCCTGGGGAGCCTGTGGGCTGG - Intergenic
1061640704 9:131952667-131952689 TTCCTGGGGAATTTGTAGGCAGG - Intronic
1062078862 9:134608119-134608141 TTGCTGGGGAGTCTGTGTGTGGG - Intergenic
1062441288 9:136570883-136570905 TTTCTGTGGAGGCTGTGGAGAGG - Intergenic
1062723660 9:138058891-138058913 TCCCTTTGTTGTCTGTGGGCTGG + Intronic
1185523053 X:756172-756194 GTCCTGTGCAGGCTGTGGGCTGG - Intergenic
1185523081 X:756352-756374 ATCCTGTGCAGGCTCTGGGCTGG - Intergenic
1185523119 X:756619-756641 ATCCTGTGCAGACTGTGGGCTGG - Intergenic
1185523185 X:757064-757086 GTCCTGTGCAGGCTCTGGGCTGG - Intergenic
1185523214 X:757241-757263 ATCCTGTGGAGGCTCTGGGCTGG - Intergenic
1190261118 X:48797575-48797597 TTCCTGTTGAGTGTAAGGGCAGG - Intergenic
1190288602 X:48976701-48976723 TTCCTGTGGGGTGACTGGGCTGG + Intronic
1190335019 X:49257031-49257053 CACCTATGGAGGCTGTGGGCTGG + Intronic
1190722571 X:53162109-53162131 TTCCGCTGGAGTCTGTTGGGGGG + Intergenic
1191080585 X:56505797-56505819 TGCCTGTGGAGTCTGTGCACCGG - Intergenic
1191790883 X:64970609-64970631 TCCCTGTGGAGTCTGTGGTTGGG + Intronic
1192970224 X:76220975-76220997 TTCCTGTGGAGGTGGTGGGCGGG + Intergenic
1198552805 X:137762159-137762181 ATGCTGTAGTGTCTGTGGGCAGG + Intergenic
1199535193 X:148895008-148895030 CTCCTGTGGAGTCTGCAGTCCGG + Intronic
1200150428 X:153948819-153948841 TTCCTGTGGGGTCACTGAGCAGG + Exonic
1201716048 Y:17044985-17045007 TTCCTGTGTCGTCTTTGTGCAGG - Intergenic