ID: 1124469170

View in Genome Browser
Species Human (GRCh38)
Location 15:29968407-29968429
Sequence GCCCGCGGCGCGTAGGGCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 63}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124469170_1124469179 17 Left 1124469170 15:29968407-29968429 CCGTCGCCCTACGCGCCGCGGGC 0: 1
1: 0
2: 2
3: 8
4: 63
Right 1124469179 15:29968447-29968469 GAAACCAGTCAGCGGGCACGCGG 0: 1
1: 0
2: 0
3: 8
4: 66
1124469170_1124469182 27 Left 1124469170 15:29968407-29968429 CCGTCGCCCTACGCGCCGCGGGC 0: 1
1: 0
2: 2
3: 8
4: 63
Right 1124469182 15:29968457-29968479 AGCGGGCACGCGGTACAAGGCGG 0: 1
1: 0
2: 0
3: 3
4: 23
1124469170_1124469176 -7 Left 1124469170 15:29968407-29968429 CCGTCGCCCTACGCGCCGCGGGC 0: 1
1: 0
2: 2
3: 8
4: 63
Right 1124469176 15:29968423-29968445 CGCGGGCACAGCGAGGGTCTCGG 0: 1
1: 0
2: 0
3: 10
4: 80
1124469170_1124469178 10 Left 1124469170 15:29968407-29968429 CCGTCGCCCTACGCGCCGCGGGC 0: 1
1: 0
2: 2
3: 8
4: 63
Right 1124469178 15:29968440-29968462 TCTCGGCGAAACCAGTCAGCGGG 0: 1
1: 0
2: 0
3: 1
4: 34
1124469170_1124469181 24 Left 1124469170 15:29968407-29968429 CCGTCGCCCTACGCGCCGCGGGC 0: 1
1: 0
2: 2
3: 8
4: 63
Right 1124469181 15:29968454-29968476 GTCAGCGGGCACGCGGTACAAGG 0: 1
1: 0
2: 0
3: 2
4: 42
1124469170_1124469177 9 Left 1124469170 15:29968407-29968429 CCGTCGCCCTACGCGCCGCGGGC 0: 1
1: 0
2: 2
3: 8
4: 63
Right 1124469177 15:29968439-29968461 GTCTCGGCGAAACCAGTCAGCGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124469170 Original CRISPR GCCCGCGGCGCGTAGGGCGA CGG (reversed) Intronic
906078377 1:43068329-43068351 GCCCGCGGGGCGCTGGGCGCGGG + Intergenic
912270139 1:108200274-108200296 GGCTGCGGCGCGCAGGGCGCAGG + Exonic
1070835663 10:79445562-79445584 GCGCGCGGGGCGCAGGGCGCGGG - Exonic
1071544813 10:86521411-86521433 GCCCGCGGGCCGTAGGGAGCGGG - Exonic
1083999594 11:66288939-66288961 GCCCACGGTGCGTGGGGCGCGGG - Exonic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1084888137 11:72223856-72223878 GCGGGCGGCGCGGAGGGCGGGGG + Intronic
1084975360 11:72794189-72794211 GCCCGCGGCATGTTGGGAGATGG + Intergenic
1091750886 12:3020660-3020682 GCCGGGGGCGCAGAGGGCGATGG - Exonic
1100330020 12:93572990-93573012 GCAGGCGGCGCGTCTGGCGAAGG + Exonic
1106422549 13:29595702-29595724 GCGCGGGGCGCGGAGCGCGAGGG - Intergenic
1122974683 14:105166218-105166240 GCCCGCGGGGCGAAGAGCCAGGG + Intronic
1124469170 15:29968407-29968429 GCCCGCGGCGCGTAGGGCGACGG - Intronic
1126626091 15:50686884-50686906 GCGCGCGGCGCGCAGGGAGGCGG - Intergenic
1128582341 15:68818767-68818789 GCCCCCTGCGCGGAGGGGGAAGG - Intronic
1132586021 16:706035-706057 GCCCGCGGCGAGCGGGGCGGGGG - Intronic
1135517555 16:23148720-23148742 GGCCGCGGCGCGCAGGGCCAGGG - Exonic
1136585316 16:31180627-31180649 ACCCGCGCCGCGAAGGGGGAGGG - Intronic
1138327882 16:56191092-56191114 GCCGCCGGCGCGTGGGGCGGGGG + Intergenic
1139484593 16:67248646-67248668 GCCCGCAGCGGGAAGGGCGGGGG - Intronic
1143411862 17:6713876-6713898 GCCCGCGGTGCGGAGGGCGCGGG - Intergenic
1146909737 17:36641164-36641186 GCGCGGGGGGCGGAGGGCGAGGG + Intergenic
1148615522 17:48997508-48997530 GCCCGCGGCGCGCAGGGAGACGG - Exonic
1148852231 17:50560900-50560922 GCCCGCGGCGGGGCGGGGGAAGG + Intergenic
1149512621 17:57256246-57256268 GCCGGCAGGGCGCAGGGCGAGGG - Intronic
1152655004 17:81515152-81515174 GCCCGCGGGGCGCAGGGGGCTGG + Intronic
1152714341 17:81891354-81891376 GCCCGCGGCGCGGCCGGCGGAGG - Exonic
1156079534 18:33316463-33316485 GCCCACGGCGTGTGGGGGGAGGG - Intronic
1156214033 18:34977756-34977778 GCCCCGGGAGCGCAGGGCGAGGG + Intronic
1160725547 19:616475-616497 GCCCGCGGGGCGGTCGGCGAGGG - Exonic
1161521122 19:4723917-4723939 GCCCGCGGCGCGGCGGCCTAAGG + Intronic
1161959609 19:7516358-7516380 GCCGGCGGCGCGCAGGGCGGGGG - Intronic
1162007293 19:7788707-7788729 GCCTGCGGCGAGTGGGGCGGCGG + Intergenic
1162118165 19:8444864-8444886 GCCCGGGGCGAGTGGGGCCAAGG + Intronic
1162832972 19:13298655-13298677 GCCCGGGGCGGCGAGGGCGAGGG - Exonic
1162902467 19:13803345-13803367 ACCCGTGGCGCTTGGGGCGAGGG - Intronic
1163774819 19:19211952-19211974 GCCAGCGGAGCGCAGGGCGCAGG + Exonic
1166219128 19:41353896-41353918 GCCCAGGGCGCGAAGGGCGGCGG + Exonic
1168641384 19:58034050-58034072 GCCCGCGGCGCGCAGGGTGCGGG + Exonic
1168753104 20:297662-297684 GCCCGGGGCGAGGAGGCCGACGG + Exonic
1172284644 20:33732143-33732165 GGCCGCGGGGCGGAGGGCGCCGG + Intronic
1176135632 20:63520928-63520950 GCCCGAGGGGCGGGGGGCGAGGG + Intronic
1176286310 21:5021130-5021152 GCCCGCGGAGTGCAGGGCGGAGG - Intergenic
1179870871 21:44242345-44242367 GCCCGCGGAGTGCAGGGCGGAGG + Intergenic
1183525017 22:38317528-38317550 GCCCCCAGCGCGGAGGGCGCGGG - Intronic
1184711366 22:46251041-46251063 GCCCGCGGCGGCTGGGGCGAGGG - Intergenic
953246716 3:41199833-41199855 GCCCGGGGCGCGGAGGGCGGCGG + Intronic
955060141 3:55486805-55486827 GCGCCCGGCGTGGAGGGCGAAGG + Intronic
956678059 3:71753805-71753827 GCCCGCGGCGCCTAGGGCGCAGG + Intronic
961929414 3:130517259-130517281 GCCTGCGGCGCGCGGGGAGACGG - Intergenic
972765855 4:42151947-42151969 GCGTGCGGCGCGAAGGGCGGCGG + Exonic
985129219 4:186724440-186724462 GCCCGCGGCGGGGAGGGCCTGGG - Intronic
998083309 5:139294179-139294201 GGCCGCGGCGCTGAGGGGGAGGG + Intronic
1013978191 6:116100726-116100748 GCCCGCCGCGCGAGGGGCGGGGG + Intergenic
1022697876 7:32728195-32728217 GCCCGGGGCGCCAAGCGCGACGG + Intergenic
1026909525 7:74084053-74084075 GGCCGCGGGGTGTGGGGCGAGGG + Intronic
1029640202 7:101815739-101815761 GCCCGCGGAGGGGAGGGGGAGGG + Intergenic
1030262538 7:107580415-107580437 GTCCGCGGCGCGGTGGTCGAGGG + Intronic
1033145894 7:138869683-138869705 GCCCGCGGCGCTTGGCGCGCAGG + Exonic
1035747784 8:1974172-1974194 GCCCGCGGCGGGGTGGGCGGCGG + Intronic
1039884321 8:41646621-41646643 GCCCGGGGCGTGGAGGACGAGGG + Exonic
1049178000 8:141206007-141206029 GCCCAGGGCGCGGAGGGCGGCGG - Intergenic
1049707371 8:144049167-144049189 GCCGGGGGCGGGAAGGGCGAGGG - Intergenic
1051418731 9:16870518-16870540 GCCCGCGGCGTGAGGGGCAAGGG - Intronic
1056386285 9:86099595-86099617 GCCGGCGGCGCGAAGGGAGGAGG + Intronic
1060952273 9:127612032-127612054 GCGCGCGGCGCGTGAGGTGAGGG + Intergenic
1061192422 9:129089480-129089502 GCCCTCTGGGCATAGGGCGAAGG - Exonic
1061584006 9:131554841-131554863 TCCGGCGGCGCGTAGGGCGGGGG - Intergenic
1062412193 9:136431212-136431234 GCCTGCGGCGGGTGGGGGGAGGG - Intronic
1062472481 9:136712559-136712581 GCGCGCGGCCCGCATGGCGAGGG + Exonic
1062595116 9:137295886-137295908 GCCCGCACCGCGAGGGGCGAGGG - Intergenic
1186466195 X:9786235-9786257 GCCCGCGGCCCGAAGGGTGAGGG - Intronic
1186638144 X:11427789-11427811 GGCAGCGGCGCGAAGGGGGAGGG + Intronic
1200128941 X:153830727-153830749 GGCCGCGGCGCCGAGCGCGAGGG - Intergenic