ID: 1124470187

View in Genome Browser
Species Human (GRCh38)
Location 15:29977263-29977285
Sequence TTCTTCACTCATTGGTAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124470187_1124470191 7 Left 1124470187 15:29977263-29977285 CCTTACTACCAATGAGTGAAGAA No data
Right 1124470191 15:29977293-29977315 TGTTAGTCAGCAGAAAATAGTGG No data
1124470187_1124470192 29 Left 1124470187 15:29977263-29977285 CCTTACTACCAATGAGTGAAGAA No data
Right 1124470192 15:29977315-29977337 GAAGCTGTGACCTCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124470187 Original CRISPR TTCTTCACTCATTGGTAGTA AGG (reversed) Intergenic
No off target data available for this crispr