ID: 1124472791

View in Genome Browser
Species Human (GRCh38)
Location 15:30003094-30003116
Sequence GCAAAATTTTCGGCCGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124472791_1124472796 -3 Left 1124472791 15:30003094-30003116 CCACGCCCGGCCGAAAATTTTGC No data
Right 1124472796 15:30003114-30003136 TGCATTTCTAACAAGGTTTCAGG No data
1124472791_1124472797 -2 Left 1124472791 15:30003094-30003116 CCACGCCCGGCCGAAAATTTTGC No data
Right 1124472797 15:30003115-30003137 GCATTTCTAACAAGGTTTCAGGG No data
1124472791_1124472799 22 Left 1124472791 15:30003094-30003116 CCACGCCCGGCCGAAAATTTTGC No data
Right 1124472799 15:30003139-30003161 GTACTGATGCTGCAGGTCTGAGG No data
1124472791_1124472798 15 Left 1124472791 15:30003094-30003116 CCACGCCCGGCCGAAAATTTTGC No data
Right 1124472798 15:30003132-30003154 TCAGGGAGTACTGATGCTGCAGG No data
1124472791_1124472795 -10 Left 1124472791 15:30003094-30003116 CCACGCCCGGCCGAAAATTTTGC No data
Right 1124472795 15:30003107-30003129 AAAATTTTGCATTTCTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124472791 Original CRISPR GCAAAATTTTCGGCCGGGCG TGG (reversed) Intergenic
No off target data available for this crispr