ID: 1124478783

View in Genome Browser
Species Human (GRCh38)
Location 15:30059590-30059612
Sequence GACACAAACCCGAGATGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124478783_1124478794 29 Left 1124478783 15:30059590-30059612 CCGGCCCATCTCGGGTTTGTGTC No data
Right 1124478794 15:30059642-30059664 ACCAGGTCATTGTAGGCCACAGG No data
1124478783_1124478791 12 Left 1124478783 15:30059590-30059612 CCGGCCCATCTCGGGTTTGTGTC No data
Right 1124478791 15:30059625-30059647 CCCTGTGGGTGAGATGCACCAGG No data
1124478783_1124478789 -2 Left 1124478783 15:30059590-30059612 CCGGCCCATCTCGGGTTTGTGTC No data
Right 1124478789 15:30059611-30059633 TCTGGGCACATGCACCCTGTGGG No data
1124478783_1124478788 -3 Left 1124478783 15:30059590-30059612 CCGGCCCATCTCGGGTTTGTGTC No data
Right 1124478788 15:30059610-30059632 GTCTGGGCACATGCACCCTGTGG No data
1124478783_1124478793 22 Left 1124478783 15:30059590-30059612 CCGGCCCATCTCGGGTTTGTGTC No data
Right 1124478793 15:30059635-30059657 GAGATGCACCAGGTCATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124478783 Original CRISPR GACACAAACCCGAGATGGGC CGG (reversed) Intergenic
No off target data available for this crispr