ID: 1124478787

View in Genome Browser
Species Human (GRCh38)
Location 15:30059595-30059617
Sequence GCCCAGACACAAACCCGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124478787_1124478793 17 Left 1124478787 15:30059595-30059617 CCATCTCGGGTTTGTGTCTGGGC No data
Right 1124478793 15:30059635-30059657 GAGATGCACCAGGTCATTGTAGG No data
1124478787_1124478791 7 Left 1124478787 15:30059595-30059617 CCATCTCGGGTTTGTGTCTGGGC No data
Right 1124478791 15:30059625-30059647 CCCTGTGGGTGAGATGCACCAGG No data
1124478787_1124478796 30 Left 1124478787 15:30059595-30059617 CCATCTCGGGTTTGTGTCTGGGC No data
Right 1124478796 15:30059648-30059670 TCATTGTAGGCCACAGGCTCTGG No data
1124478787_1124478789 -7 Left 1124478787 15:30059595-30059617 CCATCTCGGGTTTGTGTCTGGGC No data
Right 1124478789 15:30059611-30059633 TCTGGGCACATGCACCCTGTGGG No data
1124478787_1124478788 -8 Left 1124478787 15:30059595-30059617 CCATCTCGGGTTTGTGTCTGGGC No data
Right 1124478788 15:30059610-30059632 GTCTGGGCACATGCACCCTGTGG No data
1124478787_1124478794 24 Left 1124478787 15:30059595-30059617 CCATCTCGGGTTTGTGTCTGGGC No data
Right 1124478794 15:30059642-30059664 ACCAGGTCATTGTAGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124478787 Original CRISPR GCCCAGACACAAACCCGAGA TGG (reversed) Intergenic
No off target data available for this crispr