ID: 1124478792

View in Genome Browser
Species Human (GRCh38)
Location 15:30059626-30059648
Sequence ACCTGGTGCATCTCACCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124478792_1124478802 19 Left 1124478792 15:30059626-30059648 CCTGTGGGTGAGATGCACCAGGT No data
Right 1124478802 15:30059668-30059690 TGGAAAGGGCACAGAACACGGGG No data
1124478792_1124478800 17 Left 1124478792 15:30059626-30059648 CCTGTGGGTGAGATGCACCAGGT No data
Right 1124478800 15:30059666-30059688 TCTGGAAAGGGCACAGAACACGG No data
1124478792_1124478797 4 Left 1124478792 15:30059626-30059648 CCTGTGGGTGAGATGCACCAGGT No data
Right 1124478797 15:30059653-30059675 GTAGGCCACAGGCTCTGGAAAGG No data
1124478792_1124478798 5 Left 1124478792 15:30059626-30059648 CCTGTGGGTGAGATGCACCAGGT No data
Right 1124478798 15:30059654-30059676 TAGGCCACAGGCTCTGGAAAGGG No data
1124478792_1124478796 -1 Left 1124478792 15:30059626-30059648 CCTGTGGGTGAGATGCACCAGGT No data
Right 1124478796 15:30059648-30059670 TCATTGTAGGCCACAGGCTCTGG No data
1124478792_1124478794 -7 Left 1124478792 15:30059626-30059648 CCTGTGGGTGAGATGCACCAGGT No data
Right 1124478794 15:30059642-30059664 ACCAGGTCATTGTAGGCCACAGG No data
1124478792_1124478801 18 Left 1124478792 15:30059626-30059648 CCTGTGGGTGAGATGCACCAGGT No data
Right 1124478801 15:30059667-30059689 CTGGAAAGGGCACAGAACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124478792 Original CRISPR ACCTGGTGCATCTCACCCAC AGG (reversed) Intergenic
No off target data available for this crispr