ID: 1124478794

View in Genome Browser
Species Human (GRCh38)
Location 15:30059642-30059664
Sequence ACCAGGTCATTGTAGGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124478785_1124478794 25 Left 1124478785 15:30059594-30059616 CCCATCTCGGGTTTGTGTCTGGG No data
Right 1124478794 15:30059642-30059664 ACCAGGTCATTGTAGGCCACAGG No data
1124478787_1124478794 24 Left 1124478787 15:30059595-30059617 CCATCTCGGGTTTGTGTCTGGGC No data
Right 1124478794 15:30059642-30059664 ACCAGGTCATTGTAGGCCACAGG No data
1124478792_1124478794 -7 Left 1124478792 15:30059626-30059648 CCTGTGGGTGAGATGCACCAGGT No data
Right 1124478794 15:30059642-30059664 ACCAGGTCATTGTAGGCCACAGG No data
1124478790_1124478794 -6 Left 1124478790 15:30059625-30059647 CCCTGTGGGTGAGATGCACCAGG No data
Right 1124478794 15:30059642-30059664 ACCAGGTCATTGTAGGCCACAGG No data
1124478783_1124478794 29 Left 1124478783 15:30059590-30059612 CCGGCCCATCTCGGGTTTGTGTC No data
Right 1124478794 15:30059642-30059664 ACCAGGTCATTGTAGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124478794 Original CRISPR ACCAGGTCATTGTAGGCCAC AGG Intergenic
No off target data available for this crispr