ID: 1124481282

View in Genome Browser
Species Human (GRCh38)
Location 15:30082755-30082777
Sequence CTCCCCTCTCTTAGAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124481276_1124481282 4 Left 1124481276 15:30082728-30082750 CCTCTTCTCTTCCAGAGTGGGAG No data
Right 1124481282 15:30082755-30082777 CTCCCCTCTCTTAGAGTGGGTGG No data
1124481273_1124481282 6 Left 1124481273 15:30082726-30082748 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124481282 15:30082755-30082777 CTCCCCTCTCTTAGAGTGGGTGG No data
1124481275_1124481282 5 Left 1124481275 15:30082727-30082749 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124481282 15:30082755-30082777 CTCCCCTCTCTTAGAGTGGGTGG No data
1124481271_1124481282 10 Left 1124481271 15:30082722-30082744 CCGGCCCCTCTTCTCTTCCAGAG No data
Right 1124481282 15:30082755-30082777 CTCCCCTCTCTTAGAGTGGGTGG No data
1124481278_1124481282 -7 Left 1124481278 15:30082739-30082761 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124481282 15:30082755-30082777 CTCCCCTCTCTTAGAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124481282 Original CRISPR CTCCCCTCTCTTAGAGTGGG TGG Intergenic
No off target data available for this crispr