ID: 1124487063

View in Genome Browser
Species Human (GRCh38)
Location 15:30127643-30127665
Sequence AGGCTCTGAAGAGAAGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124487063_1124487065 0 Left 1124487063 15:30127643-30127665 CCTGACTCTTCTCTTCAGAGCCT No data
Right 1124487065 15:30127666-30127688 GTTTTCTCTCCGTTTACAGATGG No data
1124487063_1124487070 16 Left 1124487063 15:30127643-30127665 CCTGACTCTTCTCTTCAGAGCCT No data
Right 1124487070 15:30127682-30127704 CAGATGGGCCAAGGTTGCTCGGG No data
1124487063_1124487066 1 Left 1124487063 15:30127643-30127665 CCTGACTCTTCTCTTCAGAGCCT No data
Right 1124487066 15:30127667-30127689 TTTTCTCTCCGTTTACAGATGGG No data
1124487063_1124487067 7 Left 1124487063 15:30127643-30127665 CCTGACTCTTCTCTTCAGAGCCT No data
Right 1124487067 15:30127673-30127695 CTCCGTTTACAGATGGGCCAAGG No data
1124487063_1124487071 23 Left 1124487063 15:30127643-30127665 CCTGACTCTTCTCTTCAGAGCCT No data
Right 1124487071 15:30127689-30127711 GCCAAGGTTGCTCGGGTGATTGG No data
1124487063_1124487069 15 Left 1124487063 15:30127643-30127665 CCTGACTCTTCTCTTCAGAGCCT No data
Right 1124487069 15:30127681-30127703 ACAGATGGGCCAAGGTTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124487063 Original CRISPR AGGCTCTGAAGAGAAGAGTC AGG (reversed) Intergenic
No off target data available for this crispr