ID: 1124487064

View in Genome Browser
Species Human (GRCh38)
Location 15:30127663-30127685
Sequence TCTGTAAACGGAGAGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124487064_1124487070 -4 Left 1124487064 15:30127663-30127685 CCTGTTTTCTCTCCGTTTACAGA No data
Right 1124487070 15:30127682-30127704 CAGATGGGCCAAGGTTGCTCGGG No data
1124487064_1124487069 -5 Left 1124487064 15:30127663-30127685 CCTGTTTTCTCTCCGTTTACAGA No data
Right 1124487069 15:30127681-30127703 ACAGATGGGCCAAGGTTGCTCGG No data
1124487064_1124487071 3 Left 1124487064 15:30127663-30127685 CCTGTTTTCTCTCCGTTTACAGA No data
Right 1124487071 15:30127689-30127711 GCCAAGGTTGCTCGGGTGATTGG No data
1124487064_1124487073 11 Left 1124487064 15:30127663-30127685 CCTGTTTTCTCTCCGTTTACAGA No data
Right 1124487073 15:30127697-30127719 TGCTCGGGTGATTGGTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124487064 Original CRISPR TCTGTAAACGGAGAGAAAAC AGG (reversed) Intergenic
No off target data available for this crispr