ID: 1124487069

View in Genome Browser
Species Human (GRCh38)
Location 15:30127681-30127703
Sequence ACAGATGGGCCAAGGTTGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124487064_1124487069 -5 Left 1124487064 15:30127663-30127685 CCTGTTTTCTCTCCGTTTACAGA No data
Right 1124487069 15:30127681-30127703 ACAGATGGGCCAAGGTTGCTCGG No data
1124487062_1124487069 16 Left 1124487062 15:30127642-30127664 CCCTGACTCTTCTCTTCAGAGCC No data
Right 1124487069 15:30127681-30127703 ACAGATGGGCCAAGGTTGCTCGG No data
1124487063_1124487069 15 Left 1124487063 15:30127643-30127665 CCTGACTCTTCTCTTCAGAGCCT No data
Right 1124487069 15:30127681-30127703 ACAGATGGGCCAAGGTTGCTCGG No data
1124487061_1124487069 23 Left 1124487061 15:30127635-30127657 CCTCAGTCCCTGACTCTTCTCTT No data
Right 1124487069 15:30127681-30127703 ACAGATGGGCCAAGGTTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124487069 Original CRISPR ACAGATGGGCCAAGGTTGCT CGG Intergenic
No off target data available for this crispr