ID: 1124487071

View in Genome Browser
Species Human (GRCh38)
Location 15:30127689-30127711
Sequence GCCAAGGTTGCTCGGGTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124487068_1124487071 -9 Left 1124487068 15:30127675-30127697 CCGTTTACAGATGGGCCAAGGTT No data
Right 1124487071 15:30127689-30127711 GCCAAGGTTGCTCGGGTGATTGG No data
1124487064_1124487071 3 Left 1124487064 15:30127663-30127685 CCTGTTTTCTCTCCGTTTACAGA No data
Right 1124487071 15:30127689-30127711 GCCAAGGTTGCTCGGGTGATTGG No data
1124487062_1124487071 24 Left 1124487062 15:30127642-30127664 CCCTGACTCTTCTCTTCAGAGCC No data
Right 1124487071 15:30127689-30127711 GCCAAGGTTGCTCGGGTGATTGG No data
1124487063_1124487071 23 Left 1124487063 15:30127643-30127665 CCTGACTCTTCTCTTCAGAGCCT No data
Right 1124487071 15:30127689-30127711 GCCAAGGTTGCTCGGGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124487071 Original CRISPR GCCAAGGTTGCTCGGGTGAT TGG Intergenic
No off target data available for this crispr