ID: 1124487726

View in Genome Browser
Species Human (GRCh38)
Location 15:30134818-30134840
Sequence CTCTGGAAGAGAAGAGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124487726_1124487737 10 Left 1124487726 15:30134818-30134840 CCGGCCCCTCTTCTCTTCCAGAG No data
Right 1124487737 15:30134851-30134873 CTCCCCTCTCTTAGAGTGGGTGG No data
1124487726_1124487743 28 Left 1124487726 15:30134818-30134840 CCGGCCCCTCTTCTCTTCCAGAG No data
Right 1124487743 15:30134869-30134891 GGTGGGGAGAGCAGTTGCCATGG No data
1124487726_1124487744 29 Left 1124487726 15:30134818-30134840 CCGGCCCCTCTTCTCTTCCAGAG No data
Right 1124487744 15:30134870-30134892 GTGGGGAGAGCAGTTGCCATGGG No data
1124487726_1124487738 11 Left 1124487726 15:30134818-30134840 CCGGCCCCTCTTCTCTTCCAGAG No data
Right 1124487738 15:30134852-30134874 TCCCCTCTCTTAGAGTGGGTGGG No data
1124487726_1124487740 12 Left 1124487726 15:30134818-30134840 CCGGCCCCTCTTCTCTTCCAGAG No data
Right 1124487740 15:30134853-30134875 CCCCTCTCTTAGAGTGGGTGGGG No data
1124487726_1124487736 7 Left 1124487726 15:30134818-30134840 CCGGCCCCTCTTCTCTTCCAGAG No data
Right 1124487736 15:30134848-30134870 CCTCTCCCCTCTCTTAGAGTGGG No data
1124487726_1124487734 6 Left 1124487726 15:30134818-30134840 CCGGCCCCTCTTCTCTTCCAGAG No data
Right 1124487734 15:30134847-30134869 GCCTCTCCCCTCTCTTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124487726 Original CRISPR CTCTGGAAGAGAAGAGGGGC CGG (reversed) Intergenic
No off target data available for this crispr