ID: 1124487730

View in Genome Browser
Species Human (GRCh38)
Location 15:30134823-30134845
Sequence TCCCACTCTGGAAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124487730_1124487738 6 Left 1124487730 15:30134823-30134845 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124487738 15:30134852-30134874 TCCCCTCTCTTAGAGTGGGTGGG No data
1124487730_1124487743 23 Left 1124487730 15:30134823-30134845 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124487743 15:30134869-30134891 GGTGGGGAGAGCAGTTGCCATGG No data
1124487730_1124487744 24 Left 1124487730 15:30134823-30134845 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124487744 15:30134870-30134892 GTGGGGAGAGCAGTTGCCATGGG No data
1124487730_1124487740 7 Left 1124487730 15:30134823-30134845 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124487740 15:30134853-30134875 CCCCTCTCTTAGAGTGGGTGGGG No data
1124487730_1124487736 2 Left 1124487730 15:30134823-30134845 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124487736 15:30134848-30134870 CCTCTCCCCTCTCTTAGAGTGGG No data
1124487730_1124487737 5 Left 1124487730 15:30134823-30134845 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124487737 15:30134851-30134873 CTCCCCTCTCTTAGAGTGGGTGG No data
1124487730_1124487734 1 Left 1124487730 15:30134823-30134845 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124487734 15:30134847-30134869 GCCTCTCCCCTCTCTTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124487730 Original CRISPR TCCCACTCTGGAAGAGAAGA GGG (reversed) Intergenic