ID: 1124487733

View in Genome Browser
Species Human (GRCh38)
Location 15:30134835-30134857
Sequence AGGGGAGAGGCCTCCCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124487733_1124487744 12 Left 1124487733 15:30134835-30134857 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124487744 15:30134870-30134892 GTGGGGAGAGCAGTTGCCATGGG No data
1124487733_1124487736 -10 Left 1124487733 15:30134835-30134857 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124487736 15:30134848-30134870 CCTCTCCCCTCTCTTAGAGTGGG No data
1124487733_1124487740 -5 Left 1124487733 15:30134835-30134857 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124487740 15:30134853-30134875 CCCCTCTCTTAGAGTGGGTGGGG No data
1124487733_1124487737 -7 Left 1124487733 15:30134835-30134857 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124487737 15:30134851-30134873 CTCCCCTCTCTTAGAGTGGGTGG No data
1124487733_1124487743 11 Left 1124487733 15:30134835-30134857 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124487743 15:30134869-30134891 GGTGGGGAGAGCAGTTGCCATGG No data
1124487733_1124487738 -6 Left 1124487733 15:30134835-30134857 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124487738 15:30134852-30134874 TCCCCTCTCTTAGAGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124487733 Original CRISPR AGGGGAGAGGCCTCCCACTC TGG (reversed) Intergenic