ID: 1124487734

View in Genome Browser
Species Human (GRCh38)
Location 15:30134847-30134869
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124487726_1124487734 6 Left 1124487726 15:30134818-30134840 CCGGCCCCTCTTCTCTTCCAGAG No data
Right 1124487734 15:30134847-30134869 GCCTCTCCCCTCTCTTAGAGTGG No data
1124487730_1124487734 1 Left 1124487730 15:30134823-30134845 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124487734 15:30134847-30134869 GCCTCTCCCCTCTCTTAGAGTGG No data
1124487731_1124487734 0 Left 1124487731 15:30134824-30134846 CCTCTTCTCTTCCAGAGTGGGAG No data
Right 1124487734 15:30134847-30134869 GCCTCTCCCCTCTCTTAGAGTGG No data
1124487728_1124487734 2 Left 1124487728 15:30134822-30134844 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124487734 15:30134847-30134869 GCCTCTCCCCTCTCTTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124487734 Original CRISPR GCCTCTCCCCTCTCTTAGAG TGG Intergenic
No off target data available for this crispr