ID: 1124487742

View in Genome Browser
Species Human (GRCh38)
Location 15:30134855-30134877
Sequence CTCCCCACCCACTCTAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124487742_1124487746 15 Left 1124487742 15:30134855-30134877 CCTCTCTTAGAGTGGGTGGGGAG No data
Right 1124487746 15:30134893-30134915 CAGCTTTCCTTGTGAGCCACAGG 0: 14
1: 6
2: 4
3: 16
4: 167
1124487742_1124487748 24 Left 1124487742 15:30134855-30134877 CCTCTCTTAGAGTGGGTGGGGAG No data
Right 1124487748 15:30134902-30134924 TTGTGAGCCACAGGTCCCTCTGG No data
1124487742_1124487743 -9 Left 1124487742 15:30134855-30134877 CCTCTCTTAGAGTGGGTGGGGAG No data
Right 1124487743 15:30134869-30134891 GGTGGGGAGAGCAGTTGCCATGG No data
1124487742_1124487744 -8 Left 1124487742 15:30134855-30134877 CCTCTCTTAGAGTGGGTGGGGAG No data
Right 1124487744 15:30134870-30134892 GTGGGGAGAGCAGTTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124487742 Original CRISPR CTCCCCACCCACTCTAAGAG AGG (reversed) Intergenic
No off target data available for this crispr