ID: 1124487743

View in Genome Browser
Species Human (GRCh38)
Location 15:30134869-30134891
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124487726_1124487743 28 Left 1124487726 15:30134818-30134840 CCGGCCCCTCTTCTCTTCCAGAG No data
Right 1124487743 15:30134869-30134891 GGTGGGGAGAGCAGTTGCCATGG No data
1124487733_1124487743 11 Left 1124487733 15:30134835-30134857 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124487743 15:30134869-30134891 GGTGGGGAGAGCAGTTGCCATGG No data
1124487739_1124487743 -7 Left 1124487739 15:30134853-30134875 CCCCTCTCTTAGAGTGGGTGGGG No data
Right 1124487743 15:30134869-30134891 GGTGGGGAGAGCAGTTGCCATGG No data
1124487728_1124487743 24 Left 1124487728 15:30134822-30134844 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124487743 15:30134869-30134891 GGTGGGGAGAGCAGTTGCCATGG No data
1124487735_1124487743 -2 Left 1124487735 15:30134848-30134870 CCTCTCCCCTCTCTTAGAGTGGG No data
Right 1124487743 15:30134869-30134891 GGTGGGGAGAGCAGTTGCCATGG No data
1124487731_1124487743 22 Left 1124487731 15:30134824-30134846 CCTCTTCTCTTCCAGAGTGGGAG No data
Right 1124487743 15:30134869-30134891 GGTGGGGAGAGCAGTTGCCATGG No data
1124487742_1124487743 -9 Left 1124487742 15:30134855-30134877 CCTCTCTTAGAGTGGGTGGGGAG No data
Right 1124487743 15:30134869-30134891 GGTGGGGAGAGCAGTTGCCATGG No data
1124487741_1124487743 -8 Left 1124487741 15:30134854-30134876 CCCTCTCTTAGAGTGGGTGGGGA No data
Right 1124487743 15:30134869-30134891 GGTGGGGAGAGCAGTTGCCATGG No data
1124487730_1124487743 23 Left 1124487730 15:30134823-30134845 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124487743 15:30134869-30134891 GGTGGGGAGAGCAGTTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124487743 Original CRISPR GGTGGGGAGAGCAGTTGCCA TGG Intergenic