ID: 1124487744

View in Genome Browser
Species Human (GRCh38)
Location 15:30134870-30134892
Sequence GTGGGGAGAGCAGTTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124487733_1124487744 12 Left 1124487733 15:30134835-30134857 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124487744 15:30134870-30134892 GTGGGGAGAGCAGTTGCCATGGG No data
1124487742_1124487744 -8 Left 1124487742 15:30134855-30134877 CCTCTCTTAGAGTGGGTGGGGAG No data
Right 1124487744 15:30134870-30134892 GTGGGGAGAGCAGTTGCCATGGG No data
1124487735_1124487744 -1 Left 1124487735 15:30134848-30134870 CCTCTCCCCTCTCTTAGAGTGGG No data
Right 1124487744 15:30134870-30134892 GTGGGGAGAGCAGTTGCCATGGG No data
1124487741_1124487744 -7 Left 1124487741 15:30134854-30134876 CCCTCTCTTAGAGTGGGTGGGGA No data
Right 1124487744 15:30134870-30134892 GTGGGGAGAGCAGTTGCCATGGG No data
1124487728_1124487744 25 Left 1124487728 15:30134822-30134844 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124487744 15:30134870-30134892 GTGGGGAGAGCAGTTGCCATGGG No data
1124487731_1124487744 23 Left 1124487731 15:30134824-30134846 CCTCTTCTCTTCCAGAGTGGGAG No data
Right 1124487744 15:30134870-30134892 GTGGGGAGAGCAGTTGCCATGGG No data
1124487739_1124487744 -6 Left 1124487739 15:30134853-30134875 CCCCTCTCTTAGAGTGGGTGGGG No data
Right 1124487744 15:30134870-30134892 GTGGGGAGAGCAGTTGCCATGGG No data
1124487730_1124487744 24 Left 1124487730 15:30134823-30134845 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124487744 15:30134870-30134892 GTGGGGAGAGCAGTTGCCATGGG No data
1124487726_1124487744 29 Left 1124487726 15:30134818-30134840 CCGGCCCCTCTTCTCTTCCAGAG No data
Right 1124487744 15:30134870-30134892 GTGGGGAGAGCAGTTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124487744 Original CRISPR GTGGGGAGAGCAGTTGCCAT GGG Intergenic
No off target data available for this crispr