ID: 1124487746

View in Genome Browser
Species Human (GRCh38)
Location 15:30134893-30134915
Sequence CAGCTTTCCTTGTGAGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124487739_1124487746 17 Left 1124487739 15:30134853-30134875 CCCCTCTCTTAGAGTGGGTGGGG No data
Right 1124487746 15:30134893-30134915 CAGCTTTCCTTGTGAGCCACAGG No data
1124487742_1124487746 15 Left 1124487742 15:30134855-30134877 CCTCTCTTAGAGTGGGTGGGGAG No data
Right 1124487746 15:30134893-30134915 CAGCTTTCCTTGTGAGCCACAGG No data
1124487741_1124487746 16 Left 1124487741 15:30134854-30134876 CCCTCTCTTAGAGTGGGTGGGGA No data
Right 1124487746 15:30134893-30134915 CAGCTTTCCTTGTGAGCCACAGG No data
1124487735_1124487746 22 Left 1124487735 15:30134848-30134870 CCTCTCCCCTCTCTTAGAGTGGG No data
Right 1124487746 15:30134893-30134915 CAGCTTTCCTTGTGAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124487746 Original CRISPR CAGCTTTCCTTGTGAGCCAC AGG Intergenic