ID: 1124487746

View in Genome Browser
Species Human (GRCh38)
Location 15:30134893-30134915
Sequence CAGCTTTCCTTGTGAGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 14, 1: 6, 2: 4, 3: 16, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124487741_1124487746 16 Left 1124487741 15:30134854-30134876 CCCTCTCTTAGAGTGGGTGGGGA No data
Right 1124487746 15:30134893-30134915 CAGCTTTCCTTGTGAGCCACAGG 0: 14
1: 6
2: 4
3: 16
4: 167
1124487739_1124487746 17 Left 1124487739 15:30134853-30134875 CCCCTCTCTTAGAGTGGGTGGGG No data
Right 1124487746 15:30134893-30134915 CAGCTTTCCTTGTGAGCCACAGG 0: 14
1: 6
2: 4
3: 16
4: 167
1124487742_1124487746 15 Left 1124487742 15:30134855-30134877 CCTCTCTTAGAGTGGGTGGGGAG No data
Right 1124487746 15:30134893-30134915 CAGCTTTCCTTGTGAGCCACAGG 0: 14
1: 6
2: 4
3: 16
4: 167
1124487735_1124487746 22 Left 1124487735 15:30134848-30134870 CCTCTCCCCTCTCTTAGAGTGGG No data
Right 1124487746 15:30134893-30134915 CAGCTTTCCTTGTGAGCCACAGG 0: 14
1: 6
2: 4
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124487746 Original CRISPR CAGCTTTCCTTGTGAGCCAC AGG Intergenic
902232922 1:15039483-15039505 CAGCTGTCCCTGTGAACCATGGG + Intronic
902702906 1:18184745-18184767 CAGCTCCTCTTGTGACCCACTGG + Intronic
905646453 1:39627903-39627925 CAGATTGCCTTTTGAGCCAAGGG - Intronic
906958574 1:50398472-50398494 CAGCTTTCCCTGTTTACCACAGG - Intergenic
910250770 1:85196468-85196490 CAGCATTTCTTGGGAGCCACTGG + Intronic
912667281 1:111593595-111593617 CAGCTTTGCTTAGAAGCCACTGG + Intronic
912727208 1:112068854-112068876 AGGCTTTCCTTGTGAGCCACAGG + Intergenic
913374740 1:118138577-118138599 CAAATTTCTTTGTGAACCACTGG + Intronic
918367302 1:183821893-183821915 CAGGGTTCCTTGTGACCCTCAGG + Intronic
919836113 1:201574626-201574648 CAGCTTTCCTTGGAAGCTGCAGG - Intergenic
920458068 1:206116299-206116321 CGGCTTCCCTTGGGGGCCACGGG - Exonic
923036247 1:230287089-230287111 CAGCTTTCCCTGTTAGCAACGGG - Intergenic
924875368 1:248097402-248097424 CAGCTTTCCTTGTTAGACATGGG - Intronic
1063088719 10:2842411-2842433 GAGCTCTCCTTAGGAGCCACAGG + Intergenic
1064231773 10:13535577-13535599 CAACTTTCCTCGAGAGCCTCTGG - Intergenic
1064608105 10:17065393-17065415 TAGCTCTCATTGTGTGCCACAGG + Intronic
1066458246 10:35590458-35590480 CAGCATTTCTGGAGAGCCACAGG + Intergenic
1067134057 10:43592841-43592863 TAGGTTTCATAGTGAGCCACAGG - Intergenic
1070565958 10:77604039-77604061 TATCTTTCCTAGGGAGCCACTGG + Intronic
1071458503 10:85869533-85869555 CAGCTTTCCTTGTCAGAATCAGG - Intronic
1074480768 10:113818288-113818310 CAGGTTGCCTGGTGAACCACAGG - Intergenic
1075792238 10:125093273-125093295 CTGTTTTCCTTGTGGGCCGCAGG - Intronic
1076396515 10:130142172-130142194 CTGCTTTCCTTGTGTGCCTGTGG + Intronic
1076718212 10:132378807-132378829 CAGGCTTCCTGGTGAGCCTCAGG + Exonic
1081056357 11:38414580-38414602 CAACTATGCTTGTGAGCCACAGG + Intergenic
1082932096 11:58618728-58618750 CAGCTTTCTTTAAAAGCCACTGG - Exonic
1089202517 11:116732959-116732981 CAGCTTGCCTTGTAAGGCTCGGG + Intergenic
1089491098 11:118884857-118884879 CAGGGTTCCTTGTGAGCCGACGG + Intronic
1089982197 11:122781498-122781520 CAGCTTTCCCTGTGGGACGCGGG + Intronic
1090036519 11:123254127-123254149 CAGCTTTCCTTCTGAGCAGAGGG + Intergenic
1090278428 11:125435730-125435752 ACGCTGTCCTTGTTAGCCACAGG - Intergenic
1091347825 11:134867133-134867155 CAGCCGTCCCTGTGAGCCCCTGG + Intergenic
1092684933 12:11032395-11032417 CAGATTTTCTTGAGAACCACAGG + Intronic
1092689611 12:11093287-11093309 CAGATTTTCTTGAGAACCACAGG + Intronic
1093533112 12:20190631-20190653 CTGCTTTCCTGGAGAGCAACTGG - Intergenic
1097061914 12:56291546-56291568 CAGCTTTCTTTGGCAGCCACGGG - Intronic
1098433285 12:70443595-70443617 CAGCTTTCCTCTTGACCCAATGG + Intergenic
1098706197 12:73692966-73692988 CAACTACCCTTGTCAGCCACTGG - Intergenic
1099340073 12:81419925-81419947 CTGCTTTCCTTTTCACCCACAGG - Intronic
1099904355 12:88754296-88754318 CTCCTTTCCTTGTGAGCTAGAGG - Intergenic
1100030674 12:90186396-90186418 AAGCTTTCCTTCCTAGCCACTGG + Intergenic
1101048813 12:100839234-100839256 GAGATTTTCTTCTGAGCCACTGG - Intronic
1102998694 12:117368729-117368751 CAGCTTTCATTGAGAGCTATTGG + Intronic
1104369040 12:128206203-128206225 TTGCTTTCCTTGTGAGACTCTGG - Intergenic
1104773044 12:131376147-131376169 CAGCCTTTGTTGTGTGCCACCGG + Intergenic
1106057107 13:26248557-26248579 CAGCTTGCCTTGTTAGTCAGGGG + Intergenic
1110249195 13:73362777-73362799 CAGTTTTTATTGTGAGCAACTGG - Intergenic
1113570848 13:111356364-111356386 CAGACTTCCTTGTGGGCGACTGG + Intergenic
1113614178 13:111669508-111669530 CAGCGGTCCTTGTGAGCGCCTGG - Intronic
1115242517 14:31263765-31263787 CAGCATCCCATGTGAGTCACAGG + Intergenic
1118348789 14:64958988-64959010 CAGGTTTGCTGGTGACCCACAGG + Intronic
1119084225 14:71725161-71725183 TAGCTTTCCATAGGAGCCACAGG - Intronic
1119592245 14:75900524-75900546 CAGCTTTCCAGGTGAGCCTGGGG - Intronic
1120140830 14:80927619-80927641 CAGCCTCCCTTCTGGGCCACTGG - Intronic
1123471945 15:20562218-20562240 CAGCTTTCCTCGTGAGCCAAAGG + Intergenic
1123646059 15:22438135-22438157 CAGCTTTCCTTGTGAGCCAAAGG - Intergenic
1123667367 15:22617990-22618012 CAGCTTTCCTTGTGAGCCACAGG - Intergenic
1123732248 15:23157209-23157231 CAGCTTTCCTTGTGAGCCAAAGG + Intergenic
1123750383 15:23354591-23354613 CAGCTTTCCTTGTGAGCCAAAGG + Intergenic
1124282753 15:28378507-28378529 CAGCTTTCCTTGTGAGCCAAAGG + Intergenic
1124299946 15:28533106-28533128 CAGCTTTCCTTGTGAGCCAAAGG - Intergenic
1124321209 15:28712557-28712579 CAGCTTTCCTTGTGAGCCACAGG - Intronic
1124481291 15:30082797-30082819 CAGCTTTCCTTGTGAGCCACAGG + Intergenic
1124487746 15:30134893-30134915 CAGCTTTCCTTGTGAGCCACAGG + Intergenic
1124522307 15:30414396-30414418 CAGCTTTCCTTGTGAGCCACAGG - Intergenic
1124536357 15:30551822-30551844 CAGCTTTCCTTGTGAGCCACAGG + Intergenic
1124542836 15:30603870-30603892 CAGCTTTCCTTGTGAGCCACAGG + Intergenic
1124562792 15:30791319-30791341 CAGCTTTCCTTGTGAGCCACAGG + Intergenic
1124755782 15:32403428-32403450 CAGCTTTCCTTGTGAGCCACAGG - Intergenic
1124762294 15:32455770-32455792 CAGCTTTCCTTGTGAGCCACAGG - Intergenic
1124776337 15:32593300-32593322 CAGCTTTCCTTGTGAGCCACAGG + Intergenic
1124960519 15:34389925-34389947 CAGCTTTCCTGATGAGCCACAGG - Intronic
1124977148 15:34536146-34536168 CAGCTTTCCTGATGAGCCACAGG - Intronic
1126216224 15:46157757-46157779 CAGCTTCCCTTGTGGCCCAGAGG - Intergenic
1127299572 15:57639634-57639656 CACCTCGGCTTGTGAGCCACAGG - Intronic
1128289653 15:66467855-66467877 GATCTTTGCTTGTGAGCCACCGG - Intronic
1128367421 15:67014123-67014145 CAACTTTCCTTCGGAGCCAATGG - Intergenic
1128728953 15:70007665-70007687 CAGCTGTCCTTGAGTGCTACAGG + Intergenic
1131187919 15:90291742-90291764 CAGCTTTCCTTGTGAACCACAGG + Intronic
1131937514 15:97522859-97522881 CAGCTTTTCTTCCCAGCCACAGG - Intergenic
1131997418 15:98145673-98145695 CAGTTTTCCTTGTTATCCAAAGG - Intergenic
1132184304 15:99790906-99790928 CAGCTTTCCTTGTGAGCCACAGG + Intergenic
1132434072 15:101782240-101782262 CAGCTTTCCTTGTGAGCCACAGG - Intergenic
1132700652 16:1220724-1220746 CAGCTTTGCCTTTGAGCCGCTGG + Exonic
1133046024 16:3088822-3088844 CAGCTTTCCCTCTGGGGCACAGG - Intergenic
1137435922 16:48454185-48454207 CAGCTTTCCTCTTGGGCCAGTGG + Intergenic
1138150991 16:54656897-54656919 CAGCCTCCCTTGTGAAGCACAGG - Intergenic
1141248513 16:82333195-82333217 CCTGTTTCCTTCTGAGCCACTGG - Intergenic
1144029119 17:11304109-11304131 CACCTTTCCTGGTGAGCGATAGG + Intronic
1144193368 17:12867135-12867157 CATGTTTCCTTGTGAGTGACAGG - Intronic
1146708917 17:35023835-35023857 CAGAGTTCCCTGTGAGCCAGCGG - Intronic
1147383975 17:40071153-40071175 CAGCCCTCCTTGCCAGCCACAGG - Intronic
1147456225 17:40539900-40539922 CAGCTCTCCAGCTGAGCCACAGG - Intergenic
1154106102 18:11524451-11524473 CAGCTTTCCTGCTCAGCCCCCGG - Intergenic
1154175635 18:12086169-12086191 CACCTTGTCATGTGAGCCACTGG - Intergenic
1156022474 18:32615869-32615891 CTGCTGTCCATGTGATCCACTGG + Intergenic
1156910317 18:42404152-42404174 CTGATTTCCCTGTGTGCCACAGG - Intergenic
1159781718 18:72667935-72667957 CAGCCTTCTATGTGAGGCACAGG - Intergenic
1163497868 19:17657085-17657107 CTGCTTCCCTTGGAAGCCACAGG + Intronic
1164985809 19:32647638-32647660 CAGTGTGTCTTGTGAGCCACAGG - Intronic
1168213732 19:54910055-54910077 CACCTTTCCTGGTGAGTAACTGG + Exonic
925808862 2:7678702-7678724 CCCCTTTCCTTCTGAACCACAGG - Intergenic
926736296 2:16075772-16075794 CGGCATTCCTTGTGGGACACAGG + Intergenic
927722053 2:25389455-25389477 AAGCTTTCCTTGGGAGGCCCTGG + Intronic
933700994 2:85255505-85255527 CAGCTTTCCCAGGGAGCCCCAGG + Intronic
938444703 2:131367710-131367732 CAGCTTTTCTGCTGGGCCACAGG - Intergenic
938656366 2:133438177-133438199 CATATTTCAGTGTGAGCCACAGG + Intronic
938758627 2:134403457-134403479 CAGCTTTCATAGTAAGCCAGGGG + Intronic
940627590 2:156194692-156194714 CAGCTTTCCTTGCGTTCCCCTGG - Intergenic
941610193 2:167652056-167652078 CTGCTTTCCTTGTTAACCCCTGG - Intergenic
945949512 2:216025318-216025340 AAGCTTTGCTTTTGAGCTACTGG - Intronic
946947750 2:224839332-224839354 CTCCTGTCCTTGTGATCCACCGG + Intronic
947991173 2:234488795-234488817 CATCTTTCCTTGTGAGATTCTGG - Intergenic
948107545 2:235427592-235427614 CAGCCTTCCTTGTGACCCAGGGG - Intergenic
1171200979 20:23242048-23242070 CATCATTCCTTAGGAGCCACCGG + Intergenic
1171458989 20:25288095-25288117 CAGCTTTTCCTCTGAGCCCCGGG + Intronic
1173974137 20:47174495-47174517 CAGTTTTGCTTGGGAGCCTCGGG + Intronic
1174209520 20:48866456-48866478 AAGCTGTCCAGGTGAGCCACAGG + Intergenic
1174868185 20:54158592-54158614 AAGCTTTGCTTTTGAGCCTCTGG - Intronic
1174999223 20:55608321-55608343 TAGCATCCCGTGTGAGCCACAGG + Intergenic
1176204105 20:63878834-63878856 CAGCTCTCCTTGAGAGCACCGGG - Intronic
1178745125 21:35242073-35242095 CATCTTTCTGTGTGAACCACAGG - Intronic
1179245887 21:39633985-39634007 CAGCTCTCCTTCTGAGTCAGTGG + Intronic
1180164461 21:46016338-46016360 CTTCTTTCCTTGTGAGACCCTGG + Intergenic
1180205944 21:46260539-46260561 CAGCCATCCTTATTAGCCACTGG - Intronic
1182832081 22:33312579-33312601 CAGATTTCTTTGGTAGCCACTGG + Intronic
1183213352 22:36464334-36464356 CAGCATCCCTTGTGAGGCAGAGG - Intergenic
1184469033 22:44685089-44685111 CAGCTTTCCCTCGGAGCCTCTGG + Intronic
1184597967 22:45525784-45525806 CACCTTTCTTTGTGAGCAGCTGG + Intronic
949134990 3:553899-553921 GAGCTTTCCTGCTGACCCACAGG - Intergenic
949570958 3:5292580-5292602 AAGCTTTCCTTCTCTGCCACAGG + Intergenic
954788681 3:53114442-53114464 CACCATTCCTTCTGAACCACAGG - Intronic
956764815 3:72475623-72475645 CAGCTGTGTTTGGGAGCCACTGG - Intergenic
956815954 3:72908480-72908502 CAGCTGTGCTTTTTAGCCACAGG + Exonic
958983948 3:100758824-100758846 CAGTTTTGCTCATGAGCCACAGG - Intronic
961110601 3:124280076-124280098 CAGTTTTCCTCGTGGTCCACTGG - Intronic
961141207 3:124558061-124558083 CACCTTCCCTAGTGAGCCTCAGG + Intronic
961661066 3:128469098-128469120 CAGCCTGCCTGGTGAGCCAGTGG + Intergenic
963874457 3:150458674-150458696 AATCTATCCTTGTGTGCCACTGG + Exonic
968389245 4:175415-175437 CAGCTACTGTTGTGAGCCACTGG + Intergenic
968749310 4:2379011-2379033 CAGGCATCCTGGTGAGCCACTGG + Intronic
969094626 4:4723038-4723060 TAGACTTCCTTGTGGGCCACTGG + Intergenic
969531263 4:7732473-7732495 CAGCCAGCCTTGTGGGCCACGGG - Intronic
971823428 4:31589536-31589558 CAGCCAACCTTGAGAGCCACTGG - Intergenic
973209132 4:47596023-47596045 AAGCTTTCCTTGTCAGCCTGTGG + Intronic
974505896 4:62771862-62771884 CAGCTTCCCTTCTGAGGGACAGG + Intergenic
975719817 4:77238604-77238626 CATCATTCCCTGTGAGCCACTGG - Intronic
976170289 4:82297079-82297101 CATCTTTCCTTGTCTGCCAGAGG + Intergenic
981898261 4:149830966-149830988 CAGCCCTACTTGTGAGACACCGG + Intergenic
986652717 5:9980205-9980227 CAGCTTTCCCTGTGATTCAGGGG - Intergenic
987838794 5:23196487-23196509 CCGCTTTTCTTATGAGCCCCTGG + Intergenic
990174012 5:53087054-53087076 CACCCTTCCCTGTGAGCCTCAGG + Intronic
994152962 5:96470806-96470828 CAGCTTACCTTAAGAGTCACTGG + Intergenic
994243870 5:97456285-97456307 AAGCTTTCCCTGTGGGTCACTGG - Intergenic
995012097 5:107267758-107267780 CGGCTTTCCGTGGAAGCCACTGG + Intergenic
995442933 5:112211912-112211934 GAGCTTACCTTTTGTGCCACAGG - Intronic
996906170 5:128603243-128603265 CTGCTTTCCTTGTATCCCACAGG + Intronic
997306927 5:132844575-132844597 CAGGTTTATTTGTGGGCCACAGG + Intergenic
999721985 5:154405253-154405275 CGGCTTTCCTTGTAAGTCACAGG - Intronic
1000595271 5:163208482-163208504 CAGATGTCATTGTAAGCCACAGG + Intergenic
1001714387 5:173802969-173802991 CAGCTTGCCATGGGAGACACTGG + Intergenic
1002093940 5:176819907-176819929 CCGCTTTACTTCTGAGCCACAGG - Intronic
1003484050 6:6560209-6560231 CTGCTTTCCTTGTGAGTGTCTGG + Intergenic
1004512980 6:16297628-16297650 CAGCTTTGCTGCTGACCCACTGG + Intergenic
1004871249 6:19906806-19906828 CAGCTTTCAATGTGGGCCCCAGG + Intergenic
1005318544 6:24628819-24628841 GAGCTCTCCTTGTGTGCCTCTGG + Intronic
1007849726 6:44791625-44791647 CAGCTTTCCTAGTGGCCCAAGGG + Intergenic
1009905738 6:69867776-69867798 CAGCGTGCCTTGTCAGCCTCAGG + Intronic
1012245172 6:96918069-96918091 CACCTTTTCTTGAGAACCACTGG + Intergenic
1012937672 6:105385022-105385044 CAGCTTTCCTTGGAAGCCTCTGG + Intronic
1013046010 6:106486118-106486140 CTGCTTTCGTTGTGTCCCACAGG + Intergenic
1014928437 6:127303759-127303781 CAGTATTCCCTGTGAGCCAGTGG + Intronic
1016446660 6:144140032-144140054 CTCCTTTCCTTGTGTGCCCCAGG - Intergenic
1016796028 6:148118572-148118594 CAGCTTTGCTTGTGAGCACAGGG + Intergenic
1017721622 6:157246908-157246930 CAGCTTTCCTTGTGTGGGGCTGG + Intergenic
1018908513 6:168088838-168088860 CAGGTGTCCGTGTGACCCACCGG + Intergenic
1018931571 6:168243368-168243390 CAGCTTTCTTTGTGATCCTCAGG - Intergenic
1022452368 7:30526442-30526464 CAGCTTTCCTTGTGAGCCACAGG - Intronic
1024697928 7:51875287-51875309 CAGCCATTCTTGTGAACCACTGG + Intergenic
1026160551 7:67864809-67864831 CAGGTCTCCCTGTGAGTCACAGG - Intergenic
1026573095 7:71548985-71549007 CAGCTTTGCTTCTGAGCCTCTGG + Intronic
1026618767 7:71932062-71932084 CAGCTTTTCTGTTGTGCCACTGG + Intronic
1030051818 7:105544898-105544920 CAGCTTTCCTTTAGAGCTTCTGG + Intronic
1033041287 7:137920826-137920848 CAGCTTTCATTCTGAACTACTGG + Intronic
1037605875 8:20436712-20436734 CAGCTTTCCTGGTGAGTGAATGG + Intergenic
1040302189 8:46193858-46193880 GGGCTTTCCGTGTGAGACACAGG - Intergenic
1040323824 8:46331226-46331248 CAGCCTTCCTCGAGAGCCACAGG - Intergenic
1040330920 8:46385375-46385397 GGGCTTTCCTTGAGAGACACAGG - Intergenic
1041520190 8:58747192-58747214 CAGGAGTCATTGTGAGCCACAGG - Intergenic
1045128827 8:99125197-99125219 CAGCTTTCAGTGTGGGCCAAAGG + Intronic
1045553745 8:103195510-103195532 CAGCTTTCATTGGGAGTCCCTGG + Intronic
1049403680 8:142442311-142442333 CAGCTCTCCTTGTGAGAACCAGG - Intergenic
1052395948 9:27938295-27938317 CTGCTTTCCCTGGGAGCCCCAGG - Intergenic
1053542433 9:38988124-38988146 CAGCTGGACTTGTGAGTCACTGG - Intergenic
1053806885 9:41811642-41811664 CAGCTGGACTTGTGAGTCACTGG - Intergenic
1054261230 9:62867032-62867054 ACACTTTCCTTGTGAGCCAGGGG + Intergenic
1054623707 9:67375785-67375807 CAGCTGGACTTGTGAGTCACTGG + Intergenic
1061872158 9:133526901-133526923 CAGCTTTCCTTGGGGGCCGGCGG - Intronic
1062044053 9:134417093-134417115 CAGCCTTCCCTGGGAGCCACTGG + Intronic
1189481117 X:41393079-41393101 CAGCTTCTCTTGAGAGCCACTGG - Intergenic
1189808802 X:44762021-44762043 CAGCTTCCAGTGTGAGGCACTGG - Intergenic
1192424220 X:71061083-71061105 CAGCGTTCATTCTGAGCCAGTGG + Exonic
1194174532 X:90629750-90629772 CAGGTTTCCTTGTGGGCCTTTGG - Intergenic
1194457538 X:94123551-94123573 CAGTATTCCTTGTGAGCCTGAGG - Intergenic
1197943964 X:131818385-131818407 CACTTTGCCTTGTGAGCAACAGG - Intergenic
1199165801 X:144673482-144673504 CAGGTTTCCTTGTGAGTGAGAGG - Intergenic
1200520745 Y:4207443-4207465 CAGGTTTCCTTGTGGGCCTTTGG - Intergenic