ID: 1124487748

View in Genome Browser
Species Human (GRCh38)
Location 15:30134902-30134924
Sequence TTGTGAGCCACAGGTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124487742_1124487748 24 Left 1124487742 15:30134855-30134877 CCTCTCTTAGAGTGGGTGGGGAG No data
Right 1124487748 15:30134902-30134924 TTGTGAGCCACAGGTCCCTCTGG No data
1124487741_1124487748 25 Left 1124487741 15:30134854-30134876 CCCTCTCTTAGAGTGGGTGGGGA No data
Right 1124487748 15:30134902-30134924 TTGTGAGCCACAGGTCCCTCTGG No data
1124487745_1124487748 -7 Left 1124487745 15:30134886-30134908 CCATGGGCAGCTTTCCTTGTGAG No data
Right 1124487748 15:30134902-30134924 TTGTGAGCCACAGGTCCCTCTGG No data
1124487739_1124487748 26 Left 1124487739 15:30134853-30134875 CCCCTCTCTTAGAGTGGGTGGGG No data
Right 1124487748 15:30134902-30134924 TTGTGAGCCACAGGTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124487748 Original CRISPR TTGTGAGCCACAGGTCCCTC TGG Intergenic
No off target data available for this crispr