ID: 1124488220

View in Genome Browser
Species Human (GRCh38)
Location 15:30137895-30137917
Sequence ATGATGTAGGGCCTTCCCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 8, 1: 0, 2: 4, 3: 14, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124488220_1124488231 21 Left 1124488220 15:30137895-30137917 CCACAGGGAAGGCCCTACATCAT 0: 8
1: 0
2: 4
3: 14
4: 122
Right 1124488231 15:30137939-30137961 AGGTAAGAGGCTCTGGGCGGAGG 0: 6
1: 13
2: 17
3: 27
4: 270
1124488220_1124488228 14 Left 1124488220 15:30137895-30137917 CCACAGGGAAGGCCCTACATCAT 0: 8
1: 0
2: 4
3: 14
4: 122
Right 1124488228 15:30137932-30137954 GATCTGGAGGTAAGAGGCTCTGG 0: 18
1: 20
2: 6
3: 24
4: 207
1124488220_1124488230 18 Left 1124488220 15:30137895-30137917 CCACAGGGAAGGCCCTACATCAT 0: 8
1: 0
2: 4
3: 14
4: 122
Right 1124488230 15:30137936-30137958 TGGAGGTAAGAGGCTCTGGGCGG 0: 8
1: 3
2: 0
3: 34
4: 345
1124488220_1124488227 8 Left 1124488220 15:30137895-30137917 CCACAGGGAAGGCCCTACATCAT 0: 8
1: 0
2: 4
3: 14
4: 122
Right 1124488227 15:30137926-30137948 CTGAAAGATCTGGAGGTAAGAGG 0: 10
1: 12
2: 24
3: 28
4: 252
1124488220_1124488229 15 Left 1124488220 15:30137895-30137917 CCACAGGGAAGGCCCTACATCAT 0: 8
1: 0
2: 4
3: 14
4: 122
Right 1124488229 15:30137933-30137955 ATCTGGAGGTAAGAGGCTCTGGG 0: 18
1: 21
2: 6
3: 21
4: 174
1124488220_1124488224 1 Left 1124488220 15:30137895-30137917 CCACAGGGAAGGCCCTACATCAT 0: 8
1: 0
2: 4
3: 14
4: 122
Right 1124488224 15:30137919-30137941 TGCTACCCTGAAAGATCTGGAGG 0: 10
1: 12
2: 12
3: 20
4: 126
1124488220_1124488223 -2 Left 1124488220 15:30137895-30137917 CCACAGGGAAGGCCCTACATCAT 0: 8
1: 0
2: 4
3: 14
4: 122
Right 1124488223 15:30137916-30137938 ATCTGCTACCCTGAAAGATCTGG 0: 10
1: 13
2: 17
3: 12
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124488220 Original CRISPR ATGATGTAGGGCCTTCCCTG TGG (reversed) Exonic