ID: 1124488223

View in Genome Browser
Species Human (GRCh38)
Location 15:30137916-30137938
Sequence ATCTGCTACCCTGAAAGATC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 10, 1: 13, 2: 17, 3: 12, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124488220_1124488223 -2 Left 1124488220 15:30137895-30137917 CCACAGGGAAGGCCCTACATCAT 0: 8
1: 0
2: 4
3: 14
4: 122
Right 1124488223 15:30137916-30137938 ATCTGCTACCCTGAAAGATCTGG 0: 10
1: 13
2: 17
3: 12
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124488223 Original CRISPR ATCTGCTACCCTGAAAGATC TGG Exonic