ID: 1124488224

View in Genome Browser
Species Human (GRCh38)
Location 15:30137919-30137941
Sequence TGCTACCCTGAAAGATCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 10, 1: 12, 2: 12, 3: 20, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124488220_1124488224 1 Left 1124488220 15:30137895-30137917 CCACAGGGAAGGCCCTACATCAT 0: 8
1: 0
2: 4
3: 14
4: 122
Right 1124488224 15:30137919-30137941 TGCTACCCTGAAAGATCTGGAGG 0: 10
1: 12
2: 12
3: 20
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124488224 Original CRISPR TGCTACCCTGAAAGATCTGG AGG Exonic