ID: 1124488224 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:30137919-30137941 |
| Sequence | TGCTACCCTGAAAGATCTGG AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 180 | |||
| Summary | {0: 10, 1: 12, 2: 12, 3: 20, 4: 126} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1124488220_1124488224 | 1 | Left | 1124488220 | 15:30137895-30137917 | CCACAGGGAAGGCCCTACATCAT | 0: 8 1: 0 2: 4 3: 14 4: 122 |
||
| Right | 1124488224 | 15:30137919-30137941 | TGCTACCCTGAAAGATCTGGAGG | 0: 10 1: 12 2: 12 3: 20 4: 126 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1124488224 | Original CRISPR | TGCTACCCTGAAAGATCTGG AGG | Exonic | ||