ID: 1124488228 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:30137932-30137954 |
Sequence | GATCTGGAGGTAAGAGGCTC TGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 275 | |||
Summary | {0: 18, 1: 20, 2: 6, 3: 24, 4: 207} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1124488222_1124488228 | 1 | Left | 1124488222 | 15:30137908-30137930 | CCTACATCATCTGCTACCCTGAA | 0: 21 1: 1 2: 11 3: 20 4: 214 |
||
Right | 1124488228 | 15:30137932-30137954 | GATCTGGAGGTAAGAGGCTCTGG | 0: 18 1: 20 2: 6 3: 24 4: 207 |
||||
1124488220_1124488228 | 14 | Left | 1124488220 | 15:30137895-30137917 | CCACAGGGAAGGCCCTACATCAT | 0: 8 1: 0 2: 4 3: 14 4: 122 |
||
Right | 1124488228 | 15:30137932-30137954 | GATCTGGAGGTAAGAGGCTCTGG | 0: 18 1: 20 2: 6 3: 24 4: 207 |
||||
1124488221_1124488228 | 2 | Left | 1124488221 | 15:30137907-30137929 | CCCTACATCATCTGCTACCCTGA | 0: 21 1: 1 2: 7 3: 12 4: 148 |
||
Right | 1124488228 | 15:30137932-30137954 | GATCTGGAGGTAAGAGGCTCTGG | 0: 18 1: 20 2: 6 3: 24 4: 207 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1124488228 | Original CRISPR | GATCTGGAGGTAAGAGGCTC TGG | Exonic | ||