ID: 1124488229

View in Genome Browser
Species Human (GRCh38)
Location 15:30137933-30137955
Sequence ATCTGGAGGTAAGAGGCTCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 18, 1: 21, 2: 6, 3: 21, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124488222_1124488229 2 Left 1124488222 15:30137908-30137930 CCTACATCATCTGCTACCCTGAA 0: 21
1: 1
2: 11
3: 20
4: 214
Right 1124488229 15:30137933-30137955 ATCTGGAGGTAAGAGGCTCTGGG 0: 18
1: 21
2: 6
3: 21
4: 174
1124488220_1124488229 15 Left 1124488220 15:30137895-30137917 CCACAGGGAAGGCCCTACATCAT 0: 8
1: 0
2: 4
3: 14
4: 122
Right 1124488229 15:30137933-30137955 ATCTGGAGGTAAGAGGCTCTGGG 0: 18
1: 21
2: 6
3: 21
4: 174
1124488221_1124488229 3 Left 1124488221 15:30137907-30137929 CCCTACATCATCTGCTACCCTGA 0: 21
1: 1
2: 7
3: 12
4: 148
Right 1124488229 15:30137933-30137955 ATCTGGAGGTAAGAGGCTCTGGG 0: 18
1: 21
2: 6
3: 21
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124488229 Original CRISPR ATCTGGAGGTAAGAGGCTCT GGG Exonic