ID: 1124488230

View in Genome Browser
Species Human (GRCh38)
Location 15:30137936-30137958
Sequence TGGAGGTAAGAGGCTCTGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 8, 1: 3, 2: 0, 3: 34, 4: 345}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124488221_1124488230 6 Left 1124488221 15:30137907-30137929 CCCTACATCATCTGCTACCCTGA 0: 21
1: 1
2: 7
3: 12
4: 148
Right 1124488230 15:30137936-30137958 TGGAGGTAAGAGGCTCTGGGCGG 0: 8
1: 3
2: 0
3: 34
4: 345
1124488220_1124488230 18 Left 1124488220 15:30137895-30137917 CCACAGGGAAGGCCCTACATCAT 0: 8
1: 0
2: 4
3: 14
4: 122
Right 1124488230 15:30137936-30137958 TGGAGGTAAGAGGCTCTGGGCGG 0: 8
1: 3
2: 0
3: 34
4: 345
1124488222_1124488230 5 Left 1124488222 15:30137908-30137930 CCTACATCATCTGCTACCCTGAA 0: 21
1: 1
2: 11
3: 20
4: 214
Right 1124488230 15:30137936-30137958 TGGAGGTAAGAGGCTCTGGGCGG 0: 8
1: 3
2: 0
3: 34
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124488230 Original CRISPR TGGAGGTAAGAGGCTCTGGG CGG Exonic