ID: 1124488231

View in Genome Browser
Species Human (GRCh38)
Location 15:30137939-30137961
Sequence AGGTAAGAGGCTCTGGGCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 6, 1: 13, 2: 17, 3: 27, 4: 270}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124488226_1124488231 -9 Left 1124488226 15:30137925-30137947 CCTGAAAGATCTGGAGGTAAGAG 0: 10
1: 12
2: 26
3: 20
4: 206
Right 1124488231 15:30137939-30137961 AGGTAAGAGGCTCTGGGCGGAGG 0: 6
1: 13
2: 17
3: 27
4: 270
1124488220_1124488231 21 Left 1124488220 15:30137895-30137917 CCACAGGGAAGGCCCTACATCAT 0: 8
1: 0
2: 4
3: 14
4: 122
Right 1124488231 15:30137939-30137961 AGGTAAGAGGCTCTGGGCGGAGG 0: 6
1: 13
2: 17
3: 27
4: 270
1124488225_1124488231 -8 Left 1124488225 15:30137924-30137946 CCCTGAAAGATCTGGAGGTAAGA 0: 10
1: 11
2: 24
3: 16
4: 198
Right 1124488231 15:30137939-30137961 AGGTAAGAGGCTCTGGGCGGAGG 0: 6
1: 13
2: 17
3: 27
4: 270
1124488221_1124488231 9 Left 1124488221 15:30137907-30137929 CCCTACATCATCTGCTACCCTGA 0: 21
1: 1
2: 7
3: 12
4: 148
Right 1124488231 15:30137939-30137961 AGGTAAGAGGCTCTGGGCGGAGG 0: 6
1: 13
2: 17
3: 27
4: 270
1124488222_1124488231 8 Left 1124488222 15:30137908-30137930 CCTACATCATCTGCTACCCTGAA 0: 21
1: 1
2: 11
3: 20
4: 214
Right 1124488231 15:30137939-30137961 AGGTAAGAGGCTCTGGGCGGAGG 0: 6
1: 13
2: 17
3: 27
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124488231 Original CRISPR AGGTAAGAGGCTCTGGGCGG AGG Exonic