ID: 1124492776

View in Genome Browser
Species Human (GRCh38)
Location 15:30168286-30168308
Sequence CCTTGTCTTTGAAATGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124492776_1124492778 -4 Left 1124492776 15:30168286-30168308 CCAGCATCATTTCAAAGACAAGG No data
Right 1124492778 15:30168305-30168327 AAGGCAAATTCTGCTCAGACAGG No data
1124492776_1124492779 17 Left 1124492776 15:30168286-30168308 CCAGCATCATTTCAAAGACAAGG No data
Right 1124492779 15:30168326-30168348 GGTCGTAAGTGACCTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124492776 Original CRISPR CCTTGTCTTTGAAATGATGC TGG (reversed) Intergenic
No off target data available for this crispr