ID: 1124496995

View in Genome Browser
Species Human (GRCh38)
Location 15:30192832-30192854
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124496995_1124497013 28 Left 1124496995 15:30192832-30192854 CCCGAGGGCTCCGGCAGCCCGCG No data
Right 1124497013 15:30192883-30192905 TGAGGTCAAGGCTGGTGCCAGGG No data
1124496995_1124497007 10 Left 1124496995 15:30192832-30192854 CCCGAGGGCTCCGGCAGCCCGCG No data
Right 1124497007 15:30192865-30192887 TCAGTCTGTCCCAGAGGGTGAGG No data
1124496995_1124497004 4 Left 1124496995 15:30192832-30192854 CCCGAGGGCTCCGGCAGCCCGCG No data
Right 1124497004 15:30192859-30192881 CCTGCCTCAGTCTGTCCCAGAGG No data
1124496995_1124497008 16 Left 1124496995 15:30192832-30192854 CCCGAGGGCTCCGGCAGCCCGCG No data
Right 1124497008 15:30192871-30192893 TGTCCCAGAGGGTGAGGTCAAGG No data
1124496995_1124497005 5 Left 1124496995 15:30192832-30192854 CCCGAGGGCTCCGGCAGCCCGCG No data
Right 1124497005 15:30192860-30192882 CTGCCTCAGTCTGTCCCAGAGGG No data
1124496995_1124497011 20 Left 1124496995 15:30192832-30192854 CCCGAGGGCTCCGGCAGCCCGCG No data
Right 1124497011 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
1124496995_1124497012 27 Left 1124496995 15:30192832-30192854 CCCGAGGGCTCCGGCAGCCCGCG No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124496995 Original CRISPR CGCGGGCTGCCGGAGCCCTC GGG (reversed) Intergenic