ID: 1124496996

View in Genome Browser
Species Human (GRCh38)
Location 15:30192833-30192855
Sequence CCGCGGGCTGCCGGAGCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124496996_1124497004 3 Left 1124496996 15:30192833-30192855 CCGAGGGCTCCGGCAGCCCGCGG No data
Right 1124497004 15:30192859-30192881 CCTGCCTCAGTCTGTCCCAGAGG No data
1124496996_1124497007 9 Left 1124496996 15:30192833-30192855 CCGAGGGCTCCGGCAGCCCGCGG No data
Right 1124497007 15:30192865-30192887 TCAGTCTGTCCCAGAGGGTGAGG No data
1124496996_1124497008 15 Left 1124496996 15:30192833-30192855 CCGAGGGCTCCGGCAGCCCGCGG No data
Right 1124497008 15:30192871-30192893 TGTCCCAGAGGGTGAGGTCAAGG No data
1124496996_1124497011 19 Left 1124496996 15:30192833-30192855 CCGAGGGCTCCGGCAGCCCGCGG No data
Right 1124497011 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
1124496996_1124497005 4 Left 1124496996 15:30192833-30192855 CCGAGGGCTCCGGCAGCCCGCGG No data
Right 1124497005 15:30192860-30192882 CTGCCTCAGTCTGTCCCAGAGGG No data
1124496996_1124497012 26 Left 1124496996 15:30192833-30192855 CCGAGGGCTCCGGCAGCCCGCGG No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data
1124496996_1124497013 27 Left 1124496996 15:30192833-30192855 CCGAGGGCTCCGGCAGCCCGCGG No data
Right 1124497013 15:30192883-30192905 TGAGGTCAAGGCTGGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124496996 Original CRISPR CCGCGGGCTGCCGGAGCCCT CGG (reversed) Intergenic
No off target data available for this crispr