ID: 1124496998

View in Genome Browser
Species Human (GRCh38)
Location 15:30192842-30192864
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124496998_1124497005 -5 Left 1124496998 15:30192842-30192864 CCGGCAGCCCGCGGTCCCCTGCC No data
Right 1124497005 15:30192860-30192882 CTGCCTCAGTCTGTCCCAGAGGG No data
1124496998_1124497007 0 Left 1124496998 15:30192842-30192864 CCGGCAGCCCGCGGTCCCCTGCC No data
Right 1124497007 15:30192865-30192887 TCAGTCTGTCCCAGAGGGTGAGG No data
1124496998_1124497013 18 Left 1124496998 15:30192842-30192864 CCGGCAGCCCGCGGTCCCCTGCC No data
Right 1124497013 15:30192883-30192905 TGAGGTCAAGGCTGGTGCCAGGG No data
1124496998_1124497011 10 Left 1124496998 15:30192842-30192864 CCGGCAGCCCGCGGTCCCCTGCC No data
Right 1124497011 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
1124496998_1124497008 6 Left 1124496998 15:30192842-30192864 CCGGCAGCCCGCGGTCCCCTGCC No data
Right 1124497008 15:30192871-30192893 TGTCCCAGAGGGTGAGGTCAAGG No data
1124496998_1124497004 -6 Left 1124496998 15:30192842-30192864 CCGGCAGCCCGCGGTCCCCTGCC No data
Right 1124497004 15:30192859-30192881 CCTGCCTCAGTCTGTCCCAGAGG No data
1124496998_1124497014 29 Left 1124496998 15:30192842-30192864 CCGGCAGCCCGCGGTCCCCTGCC No data
Right 1124497014 15:30192894-30192916 CTGGTGCCAGGGCTCTTCACCGG No data
1124496998_1124497012 17 Left 1124496998 15:30192842-30192864 CCGGCAGCCCGCGGTCCCCTGCC No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124496998 Original CRISPR GGCAGGGGACCGCGGGCTGC CGG (reversed) Intergenic