ID: 1124496999

View in Genome Browser
Species Human (GRCh38)
Location 15:30192849-30192871
Sequence AGACTGAGGCAGGGGACCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124496999_1124497013 11 Left 1124496999 15:30192849-30192871 CCCGCGGTCCCCTGCCTCAGTCT No data
Right 1124497013 15:30192883-30192905 TGAGGTCAAGGCTGGTGCCAGGG No data
1124496999_1124497007 -7 Left 1124496999 15:30192849-30192871 CCCGCGGTCCCCTGCCTCAGTCT No data
Right 1124497007 15:30192865-30192887 TCAGTCTGTCCCAGAGGGTGAGG No data
1124496999_1124497008 -1 Left 1124496999 15:30192849-30192871 CCCGCGGTCCCCTGCCTCAGTCT No data
Right 1124497008 15:30192871-30192893 TGTCCCAGAGGGTGAGGTCAAGG No data
1124496999_1124497014 22 Left 1124496999 15:30192849-30192871 CCCGCGGTCCCCTGCCTCAGTCT No data
Right 1124497014 15:30192894-30192916 CTGGTGCCAGGGCTCTTCACCGG No data
1124496999_1124497012 10 Left 1124496999 15:30192849-30192871 CCCGCGGTCCCCTGCCTCAGTCT No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data
1124496999_1124497016 30 Left 1124496999 15:30192849-30192871 CCCGCGGTCCCCTGCCTCAGTCT No data
Right 1124497016 15:30192902-30192924 AGGGCTCTTCACCGGCCACCTGG No data
1124496999_1124497011 3 Left 1124496999 15:30192849-30192871 CCCGCGGTCCCCTGCCTCAGTCT No data
Right 1124497011 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124496999 Original CRISPR AGACTGAGGCAGGGGACCGC GGG (reversed) Intergenic